Notice: Database construction is still in progress. Certain features may be incomplete, slower than usual, or temporarily unavailable while we re-ingest the knowledge graph with citation data. Thank you for your patience.
← All pathways

genetic engineering

10907 relationships annotated with this phrase. Showing first 500 of 10907.
Source entity Relationship Target entity Species
(AtLEC1, EMB 212, EMB212, LEC1, NF-YB9, AT1G21970) mutant introduced into (AGD1, VAL1, AT5G61980) (HSI2-L1, HSL1, VAL2, AT4G32010) mutant background Arabidopsis thaliana
transient transformation methods have been developed in Ceratopteris richardii 'C-fern' Ceratopteris richardii
(ATUBP5, PDE323, UBP5, AT2G40930) JAMM1, and JAMM2 may be essential for the high gene knockout efficiency in F. graminearum Fusarium graminearum
single (XXT3, AT5G07720) mutant Arabidopsis generated using CRISPR-Cas9 technology Arabidopsis thaliana
CRISPR-Cas9 technology was used to inactivate ALMT13 and ALMT14 Arabidopsis thaliana
25 DUB gene deletion mutants were successfully generated in this study Fusarium graminearum
simultaneously transforming all of the required genes into an organism may be particularly challenging
YFP-HSC70.1 fusion construct is produced in transgenic lines Arabidopsis thaliana
(ATMAPK3, ATMPK3, MPK3, AT3G45640) (ATMAPK6, ATMPK6, MAPK6, MPK6, AT2G43790) double mutant is conditional loss-of-function (ATMAPK3, ATMPK3, MPK3, AT3G45640) (ATMAPK6, ATMPK6, MAPK6, MPK6, AT2G43790) double mutant Arabidopsis thaliana
(ATUBP5, PDE323, UBP5, AT2G40930) mutant could not be obtained mutant generation Fusarium graminearum
Line mhsf3-2/m8-2 is med8hsf3 double-mutant line Phaeodactylum tricornutum
pinC mutants (pinC#10t, pinC#29, pinC#69) were created via homologous recombination in the background of a fertile Physcomitrella WT Physcomitrella patens
OsOSC10 overexpression lines (OSC10-OE) were generated Oryza sativa
Line hsf3-m1 is (ATHSF3, ATHSFA1B, HSF3, HSFA1B, AT5G16820) gene-edited algae strain Phaeodactylum tricornutum
Line hsf3-m2 is (ATHSF3, ATHSFA1B, HSF3, HSFA1B, AT5G16820) gene-edited algae strain Phaeodactylum tricornutum
Line med8-3/HSF3-GFP-3# is (MED8, AT2G03070) /HSF3-GFP-3# mutant line Phaeodactylum tricornutum
plastid transformation for expression of carboxysome shell proteins and cyanobacterial Rubisco isoform requires Rubisco isoform adapted to packaging within carboxysome carboxysome-adapted Rubisco
OsmiR396d-resistant OsGRF4 and OsGRF6 alleles can be created through CRISPR-Cas9 nickase-cytidine deaminase fusion system Oryza sativa
CRISPR-Cas9 system was employed to generate CsMATE1-edited cucumber plants Cucumis sativus
AtME4 and AtME2 are expressed under control of seed-specific promoter Glycine max
two different sgRNAs were used to mutate SlSKOR locus (Solyc11g011500) Solanum lycopersicum
artificial (MIR399, MIR399F, AT2G34208) variants were transformed and expressed by (CLEL 9, GLV2, RGF9, AT5G64770) promoter in Arabidopsis Arabidopsis thaliana
miR400-resistant forms of (PPR1, AT1G06580) and (AtPPR2, EMB2750, PPR2, AT3G06430) ( (mS76, PPR336, rPPR1, AT1G61870) and (mS77, NFD5, RPPR2, AT1G19520) ) are generated by introducing silent mutations into miRNA recognition site Arabidopsis thaliana
Line m8-2 is (MED8, AT2G03070) gene-edited algae strain Phaeodactylum tricornutum
both isoforms of AhMYB2 were overexpressed in transgenic hairy roots in amaranth Amaranthus hypochondriacus
stable genetic transformation has never been accomplished in Pteridophyta
immature thalli are most often used as explants in bryophytes
different members of OsmiR396 deleted nontransgenic mutants can be combined by CRISPR-Cas9 technology Oryza sativa
(ATSOS2, CIPK24, SNRK3.11, SOS2, AT5G35410) T168A S228D construct was transformed into sos2-2 mutant
OsOSC10 loss-of-function mutants (osc10-Cr) were generated Oryza sativa
stable genetic transformation has been accomplished in bryophytes
model cyanobacteria is easier to carry out genetic manipulation in Microcystis 7806 Synechococcus 7942; Microcystis 7806
(ATUBP5, PDE323, UBP5, AT2G40930) JAMM1, and JAMM2 could not be obtained as gene deletion mutants after screening > 100 transformants in three independent trials Fusarium graminearum
(ATSYP132, SYP132, AT5G08080) −/− homozygous mutant was not identified among CRISPR/Cas9-edited transgenic plants Oryza sativa
R2-4A mutant line has (APY2, ATAPY2, AT5G18280) knockout Arabidopsis thaliana
(DD45, EC1.2, AT2G21740) gene promoter drives expression of Cas9 Arabidopsis thaliana
tissue- and stage-specific promoters should be applied to overexpress ZmBELL10
(AtLEC2, LEC2, AT1G28300) mutant introduced into (AGD1, VAL1, AT5G61980) (HSI2-L1, HSL1, VAL2, AT4G32010) mutant background Arabidopsis thaliana
YFP-HSC70.1M construct is produced in transgenic lines Arabidopsis thaliana
YFP(s)::HSC70.1 construct is produced in transgenic lines Arabidopsis thaliana
Implementation of CRISPRi with multiplexed sgRNAs may allow achievement of poly-deletion mutants in considerably shorter time
LmPf2 overexpression was performed in wild-type strain and KMT1 inactivated strain Leptosphaeria maculans
transgenic eggplant was created to control eggplant shoot and fruit borer (SFB, Leucinodes orbonalis Guenee, Lepidoptera: Pyralidae) Solanum melongena; Leucinodes orbonalis
miR4407-resistant version of GmIPT3 (mGmIPT3) has synonymous mutations within miR4407 binding site Glycine max
(AtbZIP16, bZIP16, AT2G35530) WT overexpressing line was generated in (AtbZIP, bZIP, AT1G68880) triple mutant background Arabidopsis thaliana
acbp3-3 CRISPR line was generated in Arabidopsis thaliana Ler-0 ecotype Arabidopsis thaliana
spores are routinely used for stable transformation studies in fungi
transgenic tomato plants constitutively overexpressing CaMYB12-like were produced in tomato cv Ponderosa background Solanum lycopersicum
transgenic soybean lines overexpressing AtME4 express AtME4 (ATNADP-ME4, NADP-ME4, AT1G79750) Glycine max; Arabidopsis thaliana
higher order transporter mutant lines in cytokinin reporter background can be generated by employing Multi-Knock toolbox
fus3-3 allele is point mutation Arabidopsis thaliana
Multi-Knock toolbox is designed to overcome functional redundancy in plants
independent hsc70.1 hsp70.4 double-mutant lines were produced expressing mobile YFP-HSC70.1 and nonmobile YFP-HSC70.1M transcripts Arabidopsis thaliana
Line hsf3-m4 is (ATHSF3, ATHSFA1B, HSF3, HSFA1B, AT5G16820) gene-edited algae strain Phaeodactylum tricornutum
two independent knockout lines of CIPK-B were generated using CRISPR/Cas9 system Marchantia polymorpha
abi3-12 mutation used to construct triple mutant Arabidopsis thaliana
35S promoter-driven (ADF4, ATADF4, AT5G59890) (35S pro: ) construct is transformed into adf3-1 mutant Arabidopsis thaliana
strategy of combining increased gene expression and mutations in conserved amino acid residues was used in transgenic rice
trxB gene is disrupted by streptomycin/spectinomycin cassette Synechocystis
(MED8, AT2G03070) gene editing using Crispr-Cas9 generated four Phaeodactylum tricornutum lines carrying identical biallelic mutations in (MED8, AT2G03070) Phaeodactylum tricornutum
Two independent slskor knockout alleles (slskor-1 and slskor-2) were obtained after gene edition with CRISPR-Cas Solanum lycopersicum
plastid transformation has not yet succeeded in major grain and seed crops
HCO3− pumps BicA and SbtA require single transformations targeted at plastid envelope
fer-4 ; aha2-4 double mutants carrying mCitAHA2 fluorescent reporter Arabidopsis thaliana
pTrxQKm+ and pTrxQKm– were used to transform Synechocystis cells Synechocystis sp. PCC 6803
molecular biology tools enable generation of Nannochloropsis transformants Nannochloropsis
1598 independent transgenic T0 plants generated from genetic transformation Oryza sativa
Ceratadon purpureus are also amenable to genetic manipulation Ceratadon purpureus
C. reinhardtii undergoes nuclear transformation Chlamydomonas reinhardtii
reliable protocol for transformation of Arabidopsis plastids is not currently available chloroplast genetic engineering Arabidopsis thaliana
zinc finger nucleases will allow expression silencing constructs insertion in plant genomes
arabinofuranosidase (RsAraf1) was overexpressed in transgenic poplars Populus trichocarpa
trxQ gene is disrupted by kanamycin/spectinomycin cassette Synechocystis
marker system should not be retained in final product
ProUBQ10:GFP-VAMP711 plasmid was transformed into ost2-2D background Arabidopsis thaliana
anp triple mutant could not be obtained by crossing Arabidopsis thaliana
loss of function mutants of (AtSAM1, MAT1, METK1, SAM-1, SAM1, AT1G02500) 2, and 3 genes were created using egg cell-specific CRISPR/Cas9 system in L119 background Arabidopsis thaliana
more than 20 independent transformants were confirmed Ubi::TDC3 transgenic rice Oryza sativa
a mathematical model will allow identification of a logical sequence of gene additions to deliver progressive improvements and avoid any lethal effects
T-DNA insertion knockout lines for LPLA and (LIP2, LIP2p1, AT4G31050) are only a few available in public seed stocks Arabidopsis thaliana
STXB+/– mutant strain contains disrupted trxB gene Synechocystis
(AHA2, AtHA2, HA2, PMA2, AT4G30190) Dendra2AHA2 plants express Dendra2 fluorescent protein-tagged (AHA2, AtHA2, HA2, PMA2, AT4G30190) Arabidopsis thaliana
four-component barley stripe mosaic virus-based system allows gene cotransformation
chloroplast transformation technique allowed inactivation of plastid ndh genes ( (NDHA, ATCG01100) ndhB, (NDHC, ATCG00440) (NDHH, ATCG01110) (NDHI, ATCG01090) (NDHJ, ATCG00420) (NdhK, PSBG, ATCG00430) ) tobacco
php1,2,3 triple mutant created Oryza sativa
miR156-resistant StSPL9 OE potato plants (rSPL9 OE lines) are generated by introducing silent mutations in microRNA recognition element (MRE) potato
GAL4/UAS system is used for tissue-specific expression of dominant-negative (ACT7, AtACT7, AT5G09810) Arabidopsis thaliana
new homozygous line was generated by editing (ATHSF3, ATHSFA1B, HSF3, HSFA1B, AT5G16820) in MED8-GFP using Crispr-Cas9 Phaeodactylum tricornutum
Gmprr3b loss-of-function mutants were generated using CRISPR/Cas9 technology Glycine max
siR109944 OE plants were constructed by overexpression of siR109944 under control of 35S promoter Oryza sativa
CRISPR-mediated base-editing approach failed to obtain plants with T to C at position 1005, but generated plants with T to C at position 999 (HTD1, AT2G19540) coding sequence Oryza sativa
PpAN1-1 knockout line #6-205 is single gene knockout (SKO) line Physcomitrella patens
anti-159 plants led to development of second series of amiRNA plant expression vectors Arabidopsis thaliana
single and multiple (CDC73, PHP, AT3G22590) mutant lines created using CRISPR/Cas9 Oryza sativa
BdWRKY38-ox plants were produced in Bd21 (susceptible) background Brachipodium distachyon
(KFB20, KMD1, AT1G80440) and (KFB01, KMD2, AT1G15670) have matched genotype matched genotype Oryza sativa
maize studies benefit from genome editing protocols Zea mays
35S::YFP-H6 and 35S::H6-YFP overexpression constructs were obtained as multiple transgenic lines Glycine max
(AtDRB1, DRB1, HYL1, AT1G09700) cDNA was inserted into binary vectors Arabidopsis thaliana
siR109944 OE lines were overexpressed in Arabidopsis using Agrobacterium-mediated floral dip method Arabidopsis thaliana
CRISPR-Cas9 technology used to knock out rice RbcS multigene family Oryza sativa
four GE rice lines expressed foreign Bt cry genes Oryza sativa
double mutant (AtLHP1, LHP1, TFL2, AT5G17690) (AtCYP71, CYP71, AT3G44600) was generated from cyp71-1 and tfl2-1 alleles Arabidopsis thaliana
FBL55 OE plants were constructed by overexpression of FBL55 under control of 35S promoter Oryza sativa
zinc finger nucleases will allow site-directed mutagenesis of endogenous plant genes
HvDhn4s promoter can be used for development of strong and drought-inducible expression system in wheat Triticum aestivum
17 OsDof genes could not be mutated even after three independent transformation attempts Oryza sativa
use of natural elicitors as tools could provide route to non-constitutive expression of insect control genes
PpAN1-2 knockout line #42 is single gene knockout (SKO) line Physcomitrella patens
green area methods covers plant transformation
genetic engineering of single or multiple targets and quantitative trait loci aims to create commercial-grade cultivars with high-yielding potential under optimal and suboptimal conditions
GE plants can cause intended changes
attaching effective transit peptides to each carboxysome component may also be difficult transformation difficulty
OsCKX4 cDNA is introduced into wild-type rice Oryza sativa
35S :: CHE-GFP transgenic line is generated in Arabidopsis Arabidopsis thaliana
Arabidopsis cellulase (AtCel1) was overexpressed in transgenic poplars Populus trichocarpa
new approaches offer promise of achieving gene targeting in plants
second series of amiRNAs was constructed in pBlueGreen plant expression vector Arabidopsis thaliana
∆PpAN1-1/1-2(GFP-TUA1) #20 and #31 have single insertion of antibiotic resistance gene in PTA1 site Physcomitrella patens
CRISPR technologies and manipulation of target proteins in specific spatial or temporal settings overcome limitations of classical genetics
modular organisation combined with proof-of-concept successes in decoupling immunity from growth penalties through targeted genetic interventions
Brassica juncea has susceptibility to genetic manipulation Brassica juncea
knowledge of signaling pathways and master regulators will facilitate genetic engineering of single or multiple targets and quantitative trait loci
Agrobacterium tumefaciens cells harboring gene expression construct were used to generate transgenic hairy roots Glycine max
proof of principle for flexible late blight resistance varieties produced through cisgenesis Solanum tuberosum
CRISPR/Cas9 knockout mutations in Nipponbare GT707A3 generated 12 heterozygous mutant lines in T0 generation Oryza sativa
CRISPR-Cas-based synthetic biology in plants circumvents use of potentially integrative DNA elements
viral vectors are expected to remain powerful tools to test functionality of genes and engineered circuits
modification of hormone biosynthetic pathways facilitates generation of transgenic crop plants with enhanced abiotic stress tolerance
OsTrxh2 gene knockout mutants were generated by CRISPR/Cas9 DNA editing system Oryza sativa
replacing minimal fragments with corresponding fragments of alleles from wild relatives would provide unprecedented accuracy and speed Solanum tuberosum
synonymous codons prevents possible re-binding of TALEN construct Phaeodactylum tricornutum
17 OsDof genes without knockouts may have been due to spacer location upstream of the Dof domain Oryza sativa
triple and quadruple transformants were produced by transforming double transformant PE×PD with rice ME gene construct Oryza sativa
x1_D95N construct was cloned in pPTbsr plasmid backbone Phaeodactylum tricornutum
understanding of gene expression has been used to engineer plants
zmswi3c1 loss-of-function mutants could not be obtained by TILLING or RNA interference (RNAi) Zea mays
Lhcx4 overexpression construct was based on Lhcx4 construct used by Buck et al. (2019) Phaeodactylum tricornutum
transgene technologies allowed overcoming species barriers
knowledge of how transcription activator-like effectors bind DNA is leading to broader applications in genome engineering
CRISPR-Cas-based synthetic biology in plants avoids time-consuming and labor-intensive tissue culture processes
green area methods covers creation of populations of nearly isogenic lines (NILs)
variety of approaches were tested to allow stable transfer of genes into C. gynandra L. Cleome gynandra
pTV-NaGSNOR construct was prepared by inserting partial NaGSNOR coding sequence into pTV00 vector Nicotiana attenuata
mustard is very recalcitrant to transformation Sinapis alba
x1_D95N_E205Q construct was transformed in x1KO strain Phaeodactylum tricornutum
bryophytes allow homozygous mutant generation in 3–4 weeks
(AtDRB1, DRB1, HYL1, AT1G09700) cDNA construct was transformed into (AtDRB1, DRB1, HYL1, AT1G09700) mutant plants Arabidopsis thaliana
CrFKBP12 fused to YFP behind a constitutive promoter (pRbcs/Hsp90:CrFKBP12:YFP) was transformed into Chlamydomonas cells Chlamydomonas reinhardtii
testbed plant enables rapid generation of transgenics
very high levels of foreign (PPDK, AT4G15530) expression hampered gene introduction Oryza sativa
MD×ME cross using MD-36 and ME-4 as parents was produced by crossing Oryza sativa
enrichment strategies can be achieved through transformation of cisgenes Solanum tuberosum
similar fusion recently used for tissue-specific genetic ablation
homozygous lines were selected Arabidopsis thaliana
small number of candidate genes reported for leaf traits are manageable targets for multi-locus genome editing Zea mays
gene editing of DcWRKY75 homolog genes may provide a strategy for cultivating longer vase life carnations and other ethylene-insensitive cut flowers
P. andersonii has efficient protocols for CRISPR-Cas9 genome editing P. andersonii
genes for the biosynthesis of the natural insecticidal SLMs are available for exploitation by genetic engineering
simple method generates transformants of most closely related C4 species to A. thaliana Cleome gynandra; Arabidopsis thaliana
OsRAN2 overexpressed Arabidopsis and rice plants were generated transgenic plants Arabidopsis thaliana; Oryza sativa
engineered RGA5 variants were incorporated into transgenic rice Oryza sativa
AI, including LLMs, DL, and ML can be applied to gene modification and regulation studies
pCB2004-SUE4 construct was transferred into tobacco Nicotiana tabacum
transgenic lines were generated using two inducible promoters from Arabidopsis thaliana ( (AtSAG12, SAG12, AT5G45890) and HSP18) Agrostis stolonifera; Arabidopsis thaliana
CRISPR/Cas9 technique may provide a strategy for cultivating longer vase life carnations and other ethylene-insensitive cut flowers
knockout of single NBCL gene of P. andersonii, PanNOOT1 made nbcl mutant in a tree species P. andersonii
consumption of plants loaded with bioengineered bacterial or/and viruses raises concerns transient expression systems
T0 events yielded 43 transgenic plants Triticum aestivum
PEBV-based plant expression vector was used as plant gene expression vector Nicotiana benthamiana; Solanum lycopersicum
chloroplast genome (plastome) transformation techniques enabled mutagenic studies of higher plant Rubisco holoenzyme
plastome transformation can be performed in expanding range of plant species
genetic manipulation of (RBCL, ATCG00490) by plastome transformation in tobacco is routine but protracted process tobacco
(AtDRB1, DRB1, HYL1, AT1G09700) cDNA was inserted into binary vectors under the control of the cauliflower mosaic virus 35S promoter Arabidopsis thaliana
plant virus-based vectors do not require development of stable transformants
double transformant overproducing PEPC and ME (PE•ME) was produced by introduction of rice ME gene construct into PE-2 Oryza sativa
plants ectopically overexpressing (CYP96A15, MAH1, AT1G57750) under the control of the cauliflower mosaic virus (CaMV) 35S promoter had been generated in the mah1-1 background Arabidopsis thaliana
Arabidopsis thaliana requires 5–6 months for homozygous mutant generation Arabidopsis thaliana
biotechnology has added new possibilities of obtaining male-sterile plants
segregation data of 3A line proved integration of single copy of silencing cassette Triticum aestivum
5A and 44A T1 Torka lines had estimated number of integrated copies of 2 Triticum aestivum
soybean 60% are genetically modified (GM)
x1_motif-1 construct was transformed in x1KO strain Phaeodactylum tricornutum
control strain generated with chloramphenicol resistance gene cassette at neutral site Synechocystis
genetic engineering approaches for secondary metabolite pathways are more demanding than previously adopted genetic engineering approaches
x1_D95N construct was transformed in x1KO strain Phaeodactylum tricornutum
constitutive CaMV 35S promoter was used to generate soybean transgenic lines with GmSPX5 overexpression (i.e., OX5 and OX12)
bhlh6 (ATSPX4, SPX4, AT5G15330) double mutant was generated by crossing bhlh6-1 with (ATSPX4, SPX4, AT5G15330) Oryza sativa
hygromycin-resistant seedlings were analyzed for CRISPR editing confirmation Fragaria vesca
constitutive promoters are widely used in plant biotechnology research
plasmids were introduced into Arabidopsis (Col-0) through the floral dip method Arabidopsis thaliana
Arabidopsis 35S::ULP1-HA is experimental model organism Arabidopsis thaliana
all transformants used in this study had single transgene per haploid Oryza sativa
TDCA provides quantitative information which can be used to inform rational genetic manipulation
distantly related isoenzyme (ATSUC2, SUC2, SUT1, AT1G22710) of yeast (Saccharomyces cerevisiae) was not expected to interfere with plant antisense invertase
35S::HYL1 transgenic plants were identified individually by PCR and Southern hybridization Arabidopsis thaliana
simple method generates transformants of NAD-ME type C4 plant Cleome gynandra
transformation efficiency ranged from 0.20% to 1.40% Triticum aestivum
the present study by transforming redox-inactive variants of TRX z and (FLN1, AT3G54090) into respective Arabidopsis knockout mutant backgrounds Arabidopsis thaliana
TaCRT was over-expressed in tobacco plants Nicotiana benthamiana
co-transformed PCR-positive plants of Kontesa and Torka only one proved to be successfully co-transformed Triticum aestivum
fragment of genomic DNA of Ppc gene containing exons 8 and 9 is subcloned and mutagenized by conventional mutagenesis method Zea mays
barley was transformed with MATE genes barley
transgenic lines transformed with Pinb silencing cassette were obtained from transformation of Kontesa and Torka cultivars Triticum aestivum
transgenic lines transformed with Pina+Pinb silencing cassette were obtained from co-transformation of Kontesa and Torka cultivars Triticum aestivum
plant virus-based vectors have significantly short interval between cloning and phenotypic analysis
GaMYB2 promoter is a valuable tool for engineering cotton fibre traits Gossypium hirsutum
SlBASL promoter and CDS were cloned into level 0 MoClo part Solanum lycopersicum
site-directed mutagenesis is used to generate mutant protein constructs
CRISPR-Cas9 system is used for gene editing Arabidopsis thaliana
transfer of heterologous genes is strategy for increased accumulation of compatible solutes
empty vector pMCG was used as control Triticum aestivum
tobacco has highest transformation efficiency tobacco
transgenic approach was used to alter the level of extensins in plant cell walls
Full-length coding sequence of SlERF.C1 was amplified and inserted into the pGreenII 62SK plasmid as the effector Solanum lycopersicum
deciphering metabolic pathways of (E)-2-decenal could open up possibility of genetic engineering of (E)-2-alkenal-producing crops
Line mhsf3-1/m8-2 is med8hsf3 double-mutant line Phaeodactylum tricornutum
(ATHPA1, EMB2196, HISN6A, HPA1, AT5G10330) 10–42 is expressed in transgenic wheat lines Triticum aestivum
pinCPromCit construct was targeted to carbonic anhydrase-citrine tagged locus Physcomitrella patens
CRISPRi silencing mediated by dCas9 has been used for engineering biotechnologically desirable traits
CRISPR/ (CaS, AT5G23060) tools enable precise genetic modifications of target genes
artificial siPEPs (a-siPEPs) of LATE ELONGATED HYPOCOTYL (LHY, LHY1, AT1G01060) were transformed into Arabidopsis thaliana Arabidopsis thaliana
AtARC1 (Arabidopsis thaliana artificial ring chromosome 1) is promising vector Arabidopsis thaliana
homologous recombination was used to insert selectable npt II marker cassette into PPR_65 Physcomitrella patens
transplastomic tomato plants expressing GFP from (PSBA, ATCG00020) promoter with T7g10 5′–UTR did not develop mutant phenotype Solanum lycopersicum
YFP-SVR construct is produced in transgenic lines Arabidopsis thaliana
gene coding for the insecticidal Cry1Ac protein from Bacillus thuringiensis (Bt) is incorporated into transgenic eggplant Solanum melongena; Bacillus thuringiensis
transgenic soybean lines overexpressing AtME2 express AtME2 (NAD-ME2, AT4G00570) Glycine max; Arabidopsis thaliana
LmPf2 inactivation via CRISPR-Cas9 was performed in wild-type strain and KMT1 inactivated strain Leptosphaeria maculans
mhsf3/MED8-GFP line is new homozygous line Phaeodactylum tricornutum
transgenic Arabidopsis plants expressing VvMYBPAR were generated to express VvMYBPAR Arabidopsis thaliana
starch molecular structures can be bioengineered in the plant using mutagenesis and transgene technologies
35S::MYC2 transgenic plants were generated by overexpression of (ATMYC2, JAI1, JIN1, MYC2, RD22BP1, ZBF1, AT1G32640) cDNA Arabidopsis thaliana
multiple RbcS copies in the nucleus essentially precludes RbcS from targeted mutagenic or replacement strategies
SlNAGS1 over-expression resulted in stable homozygous transformants Arabidopsis thaliana
genetic transformation is fundamental to wheat molecular genetics and improvement Triticum aestivum
plastid stroma-localized dsRED marker pRecARED was constructed and introduced into wild-type and msl2-1; msl3-1 plants Arabidopsis thaliana
NTRC-R-GECO1 and AKDE1-R-GECO1 plasmids were cloned into SpeI-ApaLI linearized vector pGPTVII-Bar-U-RGECO1 Arabidopsis thaliana
full genomic fragment is cloned into pDONR221
pWUSpro::Ypet-N7 plasmid is transformed into (CRN, SOL2, AT5G13290) mutant background Arabidopsis thaliana
Gateway cloning is DNA construct assembly technique Arabidopsis thaliana
third allele, Mpo-mr-13-1 lof contained 393 bp deletion of complete predicted hairpin structure Marchantia polymorpha
pGWB235 vector is used for promoter cloning Arabidopsis thaliana
Arabidopsis proBZR1::BZR1-GFP is experimental model organism Arabidopsis thaliana
ML1::mCherry-RCI2A BRXL2::BRXL2-YFP R2D2 (RPS5A::DII-n3xVenus RPS5A::mDII-ntdTomato) line was generated by crossing Arabidopsis thaliana
(AtNIK3, CIK1, NIK3, AT1G60800) gene is target of CRISPR-Cas9 mutagenesis Arabidopsis thaliana
In-Fusion Advantage PCR Cloning Kit is used for DNA cloning
site-directed mutagenesis generated kinase-dead version of Mp PBLa
progeny seeds were selected with hygromycin antibiotic Arabidopsis thaliana
Arabidopsis Col-0 plants were transformed through floral dipping method Arabidopsis thaliana
pCRNpro::Ypet-N7 plasmid is constructed by LR recombination
modern techniques allow extensive manipulations necessary for introduction of complex processes such as carbon-concentrating mechanism
Antirrhinum majus was transformed with RNAi-DEF construct Antirrhinum majus
optimization of the promoters of both recombinases could greatly enhance targeting frequency at the moment of the transformation/integration event itself Arabidopsis thaliana
ScFRK1 cDNA was used to generate transgenic plants carrying ScFRK1 sense or antisense construct Solanum chacoense
knockin of fluorescent proteins at the endogenous locus using techniques such as internal tagging in organisms capable of high rates of homologous recombination Physcomitrella patens
level 0 vector constructs were further subcloned into level 1 or 2 binary constructs
JH4 entry vector was incorporated into binary vector JH19 Fragaria vesca
embryogenic callus cells is used for genetic transformation
modification of photosynthetic components can only be achieved through genetic manipulation
introducing BicA and other HCO3− transporters could be achieved by nuclear transformation and inclusion of chloroplast envelope-targeting sequences genetic engineering method
transgenic barley plants expressing (ATCKX1, CKX1, AT2G41510) or (ATCKX2, CKX2, AT2G19500) were generated using Agrobacterium tumefaciens-mediated transformation Hordeum vulgare
6His (H) and tobacco etch virus protease cleavage site (T) tags added at 5′-end of each Ub (U) moiety
transgenic plants expressing genes for production of unusual fatty acids produce seeds with only a fraction of the amount of the particular fatty acids seen in gene donor plants
tobacco lines were further bred for homozygous lines Nicotiana tabacum
assembly and functional annotation of Chlorella vulgaris 211/11P genome potentially enabled application of genome-editing technologies in this species Chlorella vulgaris
Arabidopsis (BIK1, AT2G39660) (PBL1, AT3G55450) mutant transformed with Mp PBLa under the control of the native AtBIK1 promoter Arabidopsis thaliana
seven independent FveSALAD-OE lines were obtained from 35S::FveSALAD transformation Arabidopsis thaliana
JH23-FveSALAD vector contains FveSALAD coding region Fragaria vesca
single transformations of BicA and SbtA targeted at plastid envelope should be relatively easy transformation difficulty
seven stress-responsive genes ( (ATCBF3, CBF3, DREB1A, AT4G25480) (ATSOS2, CIPK24, SNRK3.11, SOS2, AT5G35410) (ATNCED2, NCED2, AT4G18350) NPK1, (ABA3, ACI2, ATABA3, AtLOS5, GIN5, LOS5, SIR3, AT1G16540) (STZ, ZAT10, AT1G27730) (AT-NHX1, ATNHX, ATNHX1, NHX1, AT5G27150) ) transformed into rice cultivar Zhonghua 11 Oryza sativa
STXQB double mutant strain lacks trxB and trxQ genes Synechocystis
cik4-3 mutant is generated in Col-0 background Arabidopsis thaliana
triple Gateway recombination reaction is used for multi-gene construct assembly
coding regions of MpRBOH1 and MpPBLa were cloned into GreenGate entry vector pGGC
SALAD promoter and FveCUC2a promoter were assembled into pMDC162 vector Fragaria vesca
floral-dipping method is used for plant genetic transformation Arabidopsis thaliana
HTR2::CDT1a-RFP ML1::YFP-RCI2A line was generated by introducing HTR2::CDT1a-RFP into the ML1::YFP-RCI2A background Arabidopsis thaliana
level 2 was sub-cloned into pAGM4723 binary vector Solanum lycopersicum
(DROP1, LRL1, AT2G24260) (DROP2, LRL2, AT4G30980) /+ plants carrying DUO1-RFP were generated transgenic plants Arabidopsis thaliana
JH19-SALADg1g2 construct contains gRNA1 and gRNA2 Fragaria vesca
VCLPUFA-producing transgenic Brassica juncea is generated organism Brassica juncea
Nicotiana tabacum is considered to be ideal model plant for the study of genetic engineering Nicotiana tabacum
Arabidopsis 35S::BZR1K280/320R-GFP is experimental model organism Arabidopsis thaliana
pKannibal construct is subcloned into pART27 binary vector Arabidopsis thaliana
double Gateway reaction is used for two-gene construct assembly
Mp PBLa or Mp RBOH1 variants were cloned into level 0 vector pUAP4
Golden Gate system used to generate expression constructs Arabidopsis thaliana
CRE and INT expression cassettes flanked with directly oriented site-specific recombination sites other than loxP sites Arabidopsis thaliana
steroid-inducible version of (PLT2, AT1G51190) under control of (AIL6, PLT3, AT5G10510) promoter is introduced into (AIL6, PLT3, AT5G10510) plt5-2 (AIL7, PLT7, AT5G65510) mutants Arabidopsis thaliana
Agrobacterium tumefaciens GV3103 was used for plant transformation Arabidopsis thaliana
tagged constructs were assembled into destination vector pGGHEK
35S pro:GFP-STF1 and 35S pro:GFP-STF2 overexpression vectors are constructed by cloning coding DNA sequences into pTF101 vector Glycine max
CRISPR-TSKO expressing fluorescently tagged Cas9 exclusively in the root cap is combined with guide RNAs (gRNAs) targeting (ATEBP1, ATG2, EBP1, G2p, AT3G51800) or (APG5, ATATG5, ATG5, AT5G17290) Arabidopsis thaliana
pBIB-BASTA-GWR-YFP vector is used for plant transformation Arabidopsis thaliana
transformation of the mitochondrial genome is feasible Chlamydomonas reinhardtii
site-specific mutations in (ATEIN2, CKR1, EIN2, ERA3, ORE2, ORE3, PIR2, AT5G03280) generated by CRISPR-editing Arabidopsis thaliana
46 T1 transformants raised and analyzed 46 T1 transformants Arabidopsis thaliana
fusing in-frame protein with aptamer is not necessarily required genetic manipulation of aptamer Oryza sativa
CALTPI transgene introduced into Arabidopsis ecotype Col-0 Arabidopsis thaliana
PEBV has already been developed as expression vector for reporter gene GFP Nicotiana benthamiana
(ANY1, AtCESA1, CESA1, RSW1, AT4G32410) -10 mutant introduced into (AGR, AGR1, ATPIN2, EIR1, MM31, PIN2, WAV6, AT5G57090) ::PIN1-HA; background Arabidopsis thaliana
two loss-of-function (lof) mutant alleles in Mp PHY were generated using CRISPR-Cas9 Marchantia polymorpha
strain YP890 is derivative of AXT3K Saccharomyces cerevisiae
(HTU)6 ligated with two UBQ promoters
sRNAs in homo-grafting are particularly used in genetic engineering
(AtRLP10, CLV2, AT1G65380) gene is target of CRISPR-Cas9 mutagenesis Arabidopsis thaliana
(YUC, YUC1, AT4G32540) coding sequence is amplified from Arabidopsis Col-0 cDNA Arabidopsis thaliana
A-230G transgenic plants carry Col (AGL25, FLC, FLF, RSB6, AT5G10140) with single point A to G mutation at SNP−230 Arabidopsis thaliana
SALADpro::GUS construct was transformed into YW5AF7 Fragaria vesca
two 15 nt gRNAs targeting AtFT promoter were ligated to gRNA expression vectors Arabidopsis thaliana
pBIB-BASTA-35S-GWR-YFP vector is used for plant transformation Arabidopsis thaliana
Physcomitrella patens has intrinsically efficient gene targeting Physcomitrella patens
plasmid pUG36ΔGFP lacks genes encoding phiLOV2.1 or GFP
primary lines are used as standard part Arabidopsis thaliana
transformed lines are selected on kanamycin Arabidopsis thaliana
pENTRY L1-SlABCG42-L2 was recombined with pMDC43 destination vector Arabidopsis thaliana
Golden Gate Assembly Mix is used for multi-part DNA assembly
(ATPGMP, PGM, PGM1, STF1, AT5G51820) (Glyma.18g117100) or STF2 (Glyma.08g302500) coding DNA sequences are amplified by PCR using cDNA derived from Wm82 Glycine max
engineer increased amino acid content can be accomplished using transgenic approaches
T-DNA mutagenesis was used to introduce second site mutations in the acd6-1 background Arabidopsis thaliana
Greengate cloning kit is used for assembly of (ATPAP10, PAP10, PUP1, AT2G16430) pro::RCI2A–tdTomato binary plasmid Arabidopsis thaliana
LR reaction is used for gene cloning
YFP-HSC70.1M ΔSVR construct is produced in transgenic lines Arabidopsis thaliana
knockin of fluorescent proteins at the endogenous locus in organisms with high homologous recombination can open new avenues of research Physcomitrella patens
aha2-4 insertional knockout mutant plants transformed with (AHA2, AtHA2, HA2, PMA2, AT4G30190) genomic construct containing mCitrine fluorescent tag Arabidopsis thaliana
Physcomitrella patens has efficient gene targeting Physcomitrella patens
(FUS3, AT3G26790) mutant introduced into (AGD1, VAL1, AT5G61980) (HSI2-L1, HSL1, VAL2, AT4G32010) mutant background Arabidopsis thaliana
triple xxt3xxt4xxt5 mutant Arabidopsis generated using CRISPR-Cas9 technology Arabidopsis thaliana
Line m8-4 is (MED8, AT2G03070) gene-edited algae strain Phaeodactylum tricornutum
(AtbZIP16, bZIP16, AT2G35530) C358L overexpressing line was generated in (AtbZIP, bZIP, AT1G68880) triple mutant background Arabidopsis thaliana
three homozygous med8hsf3 double-mutant lines were generated by editing (ATHSF3, ATHSFA1B, HSF3, HSFA1B, AT5G16820) in the m8-2 mutant using Crispr-Cas9 Phaeodactylum tricornutum
genetic interactions of (ABI3, AtABI3, SIS10, AT3G24650) (L1L, NF-YB6, AT5G47670) and (AtLEC1, EMB 212, EMB212, LEC1, NF-YB9, AT1G21970) as partial suppressors of the embryonic seedling phenotype dissected by making series of quadruple mutants with pairwise combinations of abi3-6 with (L1L, NF-YB6, AT5G47670) and (AtLEC1, EMB 212, EMB212, LEC1, NF-YB9, AT1G21970) in the (AGD1, VAL1, AT5G61980) (HSI2-L1, HSL1, VAL2, AT4G32010) background Arabidopsis thaliana
transient transformation methods were limited to heterologous expression in gametophytes
Pseudomonas syringae DC3000 poly-mutant strain (DC3000D28E) required 4 yr of experimentation Pseudomonas syringae
synthetic biology and genome editing will help maize adaptation to higher plant density
Jamm1 mutant could not be obtained mutant generation Fusarium graminearum
(L1L, NF-YB6, AT5G47670) mutant introduced into (AGD1, VAL1, AT5G61980) (HSI2-L1, HSL1, VAL2, AT4G32010) mutant background Arabidopsis thaliana
gRNA1 (GATCCAAGGTGCCTCGTCTG) and gRNA2 (GATGTTTAGAAGCATGAGGGG) were inserted into JH4 entry vector Fragaria vesca
pEntry vector is used for gene cloning
plastid transformation is a better option than nuclear transformation nuclear transformation
introducing proteins allows avoidance of need to remove protein-encoding DNA fragments from engineered plant genome
Cre protein delivery did not introduce additional selectable marker genes Zea mays
MdBT2 was transformed ectopically into mutant (ATBT2, BT2, AT3G48360) Arabidopsis thaliana
efficient silencing of up to 16 genes from the TALE family using a single sgRNA is more efficient than obtention of the equivalent poly-deletion mutant strain through sequential mutagenesis of each individual tale gene Xanthomonas
site mutations and chimera constructs were generated using previously described methods
certain varieties such as Zhonghua 11 and Hwarang in rice and C01 in maize are popular as recipients for transformation Oryza sativa; Zea mays
CRISPR-Cas9 technology was used to generate single, double, and triple mutants among (XXT3, AT5G07720) (XXT4, AT1G18690) and (XXT5, AT1G74380) Arabidopsis thaliana
Line med8-2/HSF3-GFP-3# is (MED8, AT2G03070) /HSF3-GFP-3# mutant line Phaeodactylum tricornutum
(CYP75B1, D501, TT7, AT5G07990) gene was chosen as target to generate CRISPR-edited plants Arabidopsis thaliana
genetic engineering for disease resistance can facilitate interspecific transfer of resistance genes
genetically modified (GM) crops perceived as gene revolution in agriculture
improvements to transformation will make it easier to deliver large constructs into wheat genome Triticum aestivum
biofortification is application of genetic engineering
(AtCAPE9, ATPR1, PR 1, PR1, AT2G14610) and PR1a promoters were cloned and fused to the firefly LUC reporter plasmids along with renilla luciferase (REN) driven by the Mini 35S promoter as control Solanum lycopersicum
Line mhsf3-3/m8-2 is med8hsf3 double-mutant line Phaeodactylum tricornutum
transient transformation methods have been developed in Pteris vittata Pteris vittata
stable transformation studies have not been reported in cv C-fern Ceratopteris richardii
(ATHSF3, ATHSFA1B, HSF3, HSFA1B, AT5G16820) gene editing using Crispr-Cas9 generated four homozygous Phaeodactylum tricornutum lines carrying mutations in (ATHSF3, ATHSFA1B, HSF3, HSFA1B, AT5G16820) Phaeodactylum tricornutum
CRISPR/Cas9 double-knockout transformation approach was used to target orthologous genes of (CYP86, CYP86A1, HORST, AT5G58860) and (CYP86B1, AT5G23190) Populus × canescens
abi3-6 allele is deletion mutation Arabidopsis thaliana
Jamm2 mutant could not be obtained mutant generation Fusarium graminearum
Pro 35S : AtRPL10s-GFP constructs were generated in Arabidopsis transgenic plants Arabidopsis thaliana
Line med8-1/HSF3-GFP-3# is (MED8, AT2G03070) /HSF3-GFP-3# mutant line Phaeodactylum tricornutum
(PYL9, RCAR1, AT1G01360) (PYL10, RCAR4, AT4G27920) double mutants were generated by CRISPR/Cas9-mediated genome editing
use of genome editing tools for site-specific insertion of transgenes promotes adoption in a combined strategy
combination of (PSBA, ATCG00020) promoter with T7g10 or 5′–UTR results in entirely normal phenotype Solanum lycopersicum
de novo formation of maize artificial chromosomes by particle bombardment has been reported in maize Zea mays
double mutant plants were transformed with (ATCDS1, CDS1, AT1G62430) or (CDS2, AT4G22340) cDNA under the control of the XVE-Olex-46 promoter system Arabidopsis thaliana
11-kb DNA fragment harboring a single coding sequence, the Vat-resistant allele with its native promoter and terminator was introduced via Agrobacterium-mediated transformation Cucumis melo
future polycistronic operons will usher in new age of plastid synthetic biology
loose cluster bunch trait can be introduced into other cultivars using CRISPR-Cas9 technology Vitis vinifera
(54CP, CPSRP54, FFC, SRP54CP, AT5G03940) and other members of the CpSRP pathway have been suggested to be suitable universal targets for gene editing Chlamydomonas reinhardtii
(54CP, CPSRP54, FFC, SRP54CP, AT5G03940) and other members of the CpSRP pathway are suitable for gene editing with the purpose of minimizing the chlorophyll antenna size in microalgae Chlamydomonas reinhardtii
lack of efficient regeneration and transformation protocol for moso bamboo prevents availability of DNA methyltransferase mutants moso bamboo
zinc-finger nuclease technology can modify coding regions, introns, promoters, or 3' UTRs Chlamydomonas reinhardtii
(CESA6, E112, IXR2, PRC1, AT5G64740) -1 mutant introduced into (AGR, AGR1, ATPIN2, EIR1, MM31, PIN2, WAV6, AT5G57090) ::PIN1-HA; background Arabidopsis thaliana
separate clv1-11 pCLV1::CLV1-2×GFP line introgressed into clv1-11 clv3-2 background Arabidopsis thaliana
pWOX4::mVenus-MBD construct (pXL12) contains modules WOX4pro(A), B-dummy(B), mVenus(C), MBD(D), (WOX4, AT1G46480) terminator(E) and hygromycinR(F) Arabidopsis thaliana
artificial siPEPs (a-siPEPs) of AGAMOUS (AG) were transformed into Brachypodium Brachypodium
pENTR/D-MCS vector contains multiple cloning site
RNAi-DEF lines were obtained through highly reliable transformation protocol Antirrhinum majus
chimeric expression cassette with orf182 was transferred into Yuetai B (YB) Oryza sativa
pennycress is amenable to Agrobacterium-mediated floral dip transformation Thlaspi arvense
TaGW2-B1 mutants can be created using efficient transgene-free gene editing methods Triticum aestivum
StPHYF-RNAi construct transformed into E109 plants Solanum tuberosum
promoter and UTR elements that trigger high transgene expression levels in non-green edible tissues are of great value for high-level production of recombinant proteins in chromoplast-containing fruits and tap roots
selectable marker could also be excised in this manner to obtain final marker-free T–DNA integration event Arabidopsis thaliana
The GFP-toxin B and toxin B-YFP expressing plants had 20 and 8 independent T1 mature plants Arabidopsis thaliana
VirE2-GFP fusion construct was used to replace virE2 gene of A348 Agrobacterium tumefaciens
Trifolium alexandrinum L. was transformed with Arabidopsis HARDY gene Trifolium alexandrinum; Arabidopsis thaliana
R genes combined at single locus ensures that stack remains intact in downstream breeding programs Triticum aestivum
additional single-copy target lines to obtain a clear view of efficiency of the proposed SSI method Arabidopsis thaliana
model strain contains non-functional aminoglycoside 3′-phosphotransferase VIII (aphVIII) selection marker Chlamydomonas reinhardtii
zinc-finger nuclease technology is of special interest for advances in Chlamydomonas research and biotechnological applications Chlamydomonas reinhardtii
pOp6/LhGR system could be applied for field experiments with other transformable plant species like petunia, peanut or rice Petunia; Arachis hypogaea; Oryza sativa
Overexpression dominant negative GFP-Rop4 had eight independent lines transgenic lines Arabidopsis thaliana
OX constitutively active GFP-Rop4 seedlings had three lines Arabidopsis thaliana
H2UL-1 transgenic line was created by introducing HTC2-pUbq10-Ω-Kozak::LUC construct Arabidopsis thaliana
Gmcry1c d4 mutant is CRISPR-Cas9 knockout mutant Glycine max
(CIK4, AT5G45780) gene is target of CRISPR-Cas9 mutagenesis Arabidopsis thaliana
pENTR-D topo vector is used for (YUC, YUC1, AT4G32540) CDS cloning
inactive resistance genes from susceptible varieties could be repaired by replacing minimal fragments with corresponding fragments of alleles from wild relatives Solanum tuberosum; Solanum species
extra hurdles associated with the need to infect the plants to deliver the selected constructs appear as important limitations of available transient expression systems
bHLH6 OV and (ATSPX4, SPX4, AT5G15330) OV double overexpression lines were developed by crossing bHLH6 OV with (ATSPX4, SPX4, AT5G15330) OV Oryza sativa
insect-targeted RNA interference (RNAi) constructs expressed in transgenic plants
future developments for efficient delivery of DNA/RNA sequences and proteins into plant tissues without bacterial or viral vectors may solve limitations of available transient expression systems
LB-loxP-RB footprints should be removed from final recombinant Arabidopsis thaliana
stacking of multiple transgenes at a predicted site of integration allows control of the position in the genome Arabidopsis thaliana
engineered Camelina lines with altered seed oil compositions are rapidly achievable through Agrobacterium tumefaciens-mediated, floral-dip transformation method Camelina sativa
Line hsf3-m3 is (ATHSF3, ATHSFA1B, HSF3, HSFA1B, AT5G16820) gene-edited algae strain Phaeodactylum tricornutum
(AtLEC1, EMB 212, EMB212, LEC1, NF-YB9, AT1G21970) (L1L, NF-YB6, AT5G47670) and (AtLEC2, LEC2, AT1G28300) alleles are transfer DNA insertion mutants Arabidopsis thaliana
maize Ubiquitin (Ubi) promoter-driven expression of rice TDC3 overexpression construct (Ubi::TDC3) was introduced into wild-type cv Wuxiangjing 9 Oryza sativa
coding regions of genes analyzed amplified and cloned upstream of dsRed sequence
galactanase (Tv6GAL) was overexpressed in transgenic poplars Populus trichocarpa
transformation technology for moso bamboo is not yet available moso bamboo moso bamboo
algal CCM is attractive target for transfer
a mathematical model was used to determine a possible sequence of gene additions that would give an incremental improvement
chemically inducible C3′H expression construct transformed into reduced epidermal fluorescence8 (CYP98A3, REF8, AT2G40890) mutant Arabidopsis thaliana
a random sequence of gene stacking would likely be inefficient
some CCM components may prove more difficult to introduce than others transformation difficulty
achieving full benefit of cyanobacterial carbon-concentrating mechanism (CCM) will be considerably more challenging and most probably will depend on plastid transformation for expression of shell proteins and Rubisco isoform
flv4-2 operon was integrated into the chromosome by replacement of psbA2 gene Synechocystis
stability problem of down-regulation can be overcome by making stable ccr mutants using CRISPR/Cas9 genome-engineering technique Populus spp.
STXQ+/– mutant strain contains disrupted trxQ gene Synechocystis
homozygous knockout of LPLA or (LIP2, LIP2p1, AT4G31050) demonstrates that plants cannot tolerate deletion of either enzyme Arabidopsis thaliana
transgenic lines and their nontransgenic counterparts would be near-isogenic lines differing in one or two genes
protoplasting of Tortula thus prevents transformation Tortula
(AtbZIP16, bZIP16, AT2G35530) C330L overexpressing line was generated in (AtbZIP, bZIP, AT1G68880) triple mutant background Arabidopsis thaliana
the addition of some genes may be simply unnecessary
pBC34S plasmid was used to transform Synechocystis STXB cells Synechocystis
glass bead method is used for nuclear transformation of C. reinhardtii Chlamydomonas reinhardtii
ability to make improvements using transgenic approaches should soon be possible in pennycress Thlaspi arvense
transposons have become valuable tools for genetic manipulation
bhlh6 knockout mutants were generated via CRISPR/Cas9 Oryza sativa
transcription factor couple from Antirrhinum was introduced in tomato Solanum lycopersicum
35S::MdBT2-ovx and 35S::MdBT2-anti constructs were transformed into 35S::MdMYB1-GFP transgenic calli Malus domestica
(ATPDX1, ATPDX1.3, PDX1, PDX1.3, RSR4, AT5G01410) mutant was transformed with chimeras of promoter region fused to (ATPDX1, ATPDX1.3, PDX1, PDX1.3, RSR4, AT5G01410) or .1 coding region Arabidopsis thaliana
new expression system provides outstanding tool for genetic and metabolic engineering of microalgae Nannochloropsis oceanica
Lyu et al. (2023) used development of custom gene-edited mutants Glycine max
P. patens has amenability to gene targeting Physcomitrella patens
Aspergillus xyloglucanase (AaXEG2) was overexpressed in transgenic poplars Populus trichocarpa
Physcomitrella patens is easily transformed Physcomitrella patens
pTrxBSp+ and pTrxBSp– were used to transform WT Synechocystis cells Synechocystis sp. PCC 6803
protocol for transformation of Arabidopsis plastids would enable mutation of features and testing their influence on pausing and protein assembly Arabidopsis thaliana
R2-4A mutant line has estradiol-inducible (APY1, ATAPY1, AT3G04080) suppression Arabidopsis thaliana
aco quadruple mutant generated by genetic crossing of Arabidopsis aco T-DNA insertion lines Arabidopsis thaliana
CRISPR–Cas9-mediated genome-edited lines in rice variety Nipponbare were generated Osecs-1 and Osces-2 lines Oryza sativa
host-induced gene silencing (HIGS) has been used to silence putative effector RirG110290 called (AtCTR1, CTR1, SIS1, AT5G03730) Rhizophagus irregularis
soybean reference assembly has been used for precision gene editing Glycine max
x1_W133M transformed lines showed integration of construct Phaeodactylum tricornutum
sll0545 disruption could not be obtained desired transformant Synechocystis
enrichment strategies can be achieved through novel gene editing tools Solanum tuberosum
green area methods covers genome editing
determination of biochemical and kinetic properties of mimosine-degrading enzyme may be useful in developing transgenic Leucaena leucocephala with reduced mimosine content Leucaena leucocephala
OsmiR396d-resistant OsGRF4 and OsGRF6 alleles can convert C to T in OsmiR396 targeted DNA regions Oryza sativa
YFP-HSC70.1 ΔSVR deletion variant is produced in transgenic lines Arabidopsis thaliana
T. pseudonana has expanding and sophisticated toolbox for genetic manipulation Thalassiosira pseudonana
Line m8-3 is (MED8, AT2G03070) gene-edited algae strain Phaeodactylum tricornutum
three homozygous mutant lines were generated by editing (MED8, AT2G03070) in the HSF3- overexpression line HSF3-GFP-3# Phaeodactylum tricornutum
(ABI3, AtABI3, SIS10, AT3G24650) mutant introduced into (AGD1, VAL1, AT5G61980) (HSI2-L1, HSL1, VAL2, AT4G32010) mutant background Arabidopsis thaliana
OE-VAMP711-15 crossed into ost2-2D genetic background produces ost2-2D-OE-VAMP711 plants Arabidopsis thaliana
pTrxBSp+ and pTrxBSp– were used to transform STXQ mutant Synechocystis cells Synechocystis sp. PCC 6803
pCsFAD3:GUS transgenic plants were generated by transformation into Suneson wild-type plants Camelina sativa
enzymes producing various unusual fatty acids have been cloned and expressed in transgenic plants
silenced lines were independently complemented with each MED7 paralog using conditional expression system Arabidopsis thaliana
abi3-12 mutation is nonsense mutation Arabidopsis thaliana
Gmcry2c d4 mutant is CRISPR-Cas9 knockout mutant Glycine max
very long chain fatty acids (>C20) has transgenic plants producing them
SWAM1-OE line was developed by overexpressing the full-length coding region under the maize ubiquitin promoter Brachypodium distachyon
potential targets for biotechnological manipulation of Chlorella vulgaris for transferring specific Chlorella vulgaris 211/11P properties to other species Chlorella vulgaris
ZmPOD65 missense mutation at amino acid (aa) 73 causing a change from Met to Leu is one of two independent ZmPOD65 mutations Zea mays
11 Arabidopsis CLEs with known repressive activity were simultaneously mutated using multiplex CRISPR/Cas9 Arabidopsis thaliana
Gmcry2a d9 mutant is CRISPR-Cas9 knockout mutant Glycine max
selection of suitable targets is crucial to design of successful GE (genetic engineering) experiments
35S::GFP-BASL-IC lines were created using the construct reported in reference 13 Arabidopsis thaliana
BASL::MYR-BRX-YFP and basl-2 35S::PIP2A-RFP lines were transformed with ML1::H2B-YFP Arabidopsis thaliana
pMOA33 binary vector backbone is used as plasmid construction
putative transgenic plants are characterized using leaf painting with basta solution, qPCR analysis, and DNA sequencing Glycine max
lycophyte model is not prone to transformation
injection buffer is used for Agrobacterium infiltration Nicotiana benthamiana
construction of higher-order mutants is exceedingly difficult Arabidopsis thaliana
cyclopropane fatty acids has transgenic plants producing them
SWAM1-DR line was generated by overexpressing the full-length coding region fused to the 39-base pair dominant repressor EAR motif Brachypodium distachyon
binary vectors carry in cis LexAop sequences upstream of H2B-green fluorescent protein (GFP), H2B-yellow fluorescent protein (YFP), H2B-mKusabira Orange or H2B-mCherry Arabidopsis thaliana
CRISPR/Cas9 editing was used to introduce deletion mutations into all three TaDEP1 homoeologs Triticum aestivum
smart breeding uses complex gene modification and regulation
attempts to produce homozygous knockout lines for LPLA and (LIP2, LIP2p1, AT4G31050) failed in repeated trials homozygous knockout lines Arabidopsis thaliana
targeting vector with a loxP site at the promoterless 5′ end of the coding region of a second selectable marker may aid in obtaining precise SSI lines only Arabidopsis thaliana
crosses between pOp6 lines and other activator lines generates various functional combinations
maize orthologs of FON2 (ZmCLE7) and (CPL4, FCP1, AT5G58003) (ZmFCP1) were mutated in this study Zea mays
wild-type strain CC-124 was transformed with construct expressing amiRNA targeting CYG12 3′-UTR Chlamydomonas reinhardtii
plastid transformation has succeeded so far in only a few species transformation success
Line m8-1 is (MED8, AT2G03070) gene-edited algae strain Phaeodactylum tricornutum
Os07g0141400 knockout lines were generated using CRISPR/Cas9 system Oryza sativa
members of the CpSRP pathway can be exploited in strain optimization for high density cultivation of diatoms Phaeodactylum tricornutum
(S8H, AT3G12900) overexpression ( Ox) lines were generated using cauliflower mosaic virus (CaMV) 35S promoter Arabidopsis thaliana
site-directed mutagenesis was performed using QuikChange Site-Directed Mutagenesis Kit
changing cis-acting elements in gene promoter regions via genome editing can activate gene expression in the tissue of interest
multi-R-gene stacks can be generated through DNA engineering and transformation Triticum aestivum