| (AtLEC1, EMB 212, EMB212, LEC1, NF-YB9, AT1G21970) mutant |
introduced into |
(AGD1, VAL1, AT5G61980) (HSI2-L1, HSL1, VAL2, AT4G32010) mutant background |
Arabidopsis thaliana |
| transient transformation methods |
have been developed in |
Ceratopteris richardii 'C-fern' |
Ceratopteris richardii |
| (ATUBP5, PDE323, UBP5, AT2G40930) JAMM1, and JAMM2 |
may be |
essential for the high gene knockout efficiency in F. graminearum |
Fusarium graminearum |
| single (XXT3, AT5G07720) mutant Arabidopsis |
generated using |
CRISPR-Cas9 technology |
Arabidopsis thaliana |
| CRISPR-Cas9 technology |
was used to |
inactivate ALMT13 and ALMT14 |
Arabidopsis thaliana |
| 25 DUB gene deletion mutants |
were successfully generated |
in this study |
Fusarium graminearum |
| simultaneously transforming all of the required genes into an organism |
may be |
particularly challenging |
|
| YFP-HSC70.1 fusion construct |
is produced in |
transgenic lines |
Arabidopsis thaliana |
| (ATMAPK3, ATMPK3, MPK3, AT3G45640) (ATMAPK6, ATMPK6, MAPK6, MPK6, AT2G43790) double mutant |
is |
conditional loss-of-function (ATMAPK3, ATMPK3, MPK3, AT3G45640) (ATMAPK6, ATMPK6, MAPK6, MPK6, AT2G43790) double mutant |
Arabidopsis thaliana |
| (ATUBP5, PDE323, UBP5, AT2G40930) mutant |
could not be obtained |
mutant generation |
Fusarium graminearum |
| Line mhsf3-2/m8-2 |
is |
med8hsf3 double-mutant line |
Phaeodactylum tricornutum |
| pinC mutants (pinC#10t, pinC#29, pinC#69) |
were created via |
homologous recombination in the background of a fertile Physcomitrella WT |
Physcomitrella patens |
| OsOSC10 overexpression lines (OSC10-OE) |
were generated |
|
Oryza sativa |
| Line hsf3-m1 |
is |
(ATHSF3, ATHSFA1B, HSF3, HSFA1B, AT5G16820) gene-edited algae strain |
Phaeodactylum tricornutum |
| Line hsf3-m2 |
is |
(ATHSF3, ATHSFA1B, HSF3, HSFA1B, AT5G16820) gene-edited algae strain |
Phaeodactylum tricornutum |
| Line med8-3/HSF3-GFP-3# |
is |
(MED8, AT2G03070) /HSF3-GFP-3# mutant line |
Phaeodactylum tricornutum |
| plastid transformation for expression of carboxysome shell proteins and cyanobacterial Rubisco isoform |
requires Rubisco isoform adapted to packaging within carboxysome |
carboxysome-adapted Rubisco |
|
| OsmiR396d-resistant OsGRF4 and OsGRF6 alleles |
can be created through |
CRISPR-Cas9 nickase-cytidine deaminase fusion system |
Oryza sativa |
| CRISPR-Cas9 system |
was employed to generate |
CsMATE1-edited cucumber plants |
Cucumis sativus |
| AtME4 and AtME2 |
are expressed under control of |
seed-specific promoter |
Glycine max |
| two different sgRNAs |
were used to mutate |
SlSKOR locus (Solyc11g011500) |
Solanum lycopersicum |
| artificial (MIR399, MIR399F, AT2G34208) variants |
were |
transformed and expressed by (CLEL 9, GLV2, RGF9, AT5G64770) promoter in Arabidopsis |
Arabidopsis thaliana |
| miR400-resistant forms of (PPR1, AT1G06580) and (AtPPR2, EMB2750, PPR2, AT3G06430) ( (mS76, PPR336, rPPR1, AT1G61870) and (mS77, NFD5, RPPR2, AT1G19520) ) |
are generated by introducing |
silent mutations into miRNA recognition site |
Arabidopsis thaliana |
| Line m8-2 |
is |
(MED8, AT2G03070) gene-edited algae strain |
Phaeodactylum tricornutum |
| both isoforms of AhMYB2 |
were overexpressed in |
transgenic hairy roots in amaranth |
Amaranthus hypochondriacus |
| stable genetic transformation |
has never been accomplished in |
Pteridophyta |
|
| immature thalli |
are most often used as |
explants in bryophytes |
|
| different members of OsmiR396 deleted nontransgenic mutants |
can be combined by |
CRISPR-Cas9 technology |
Oryza sativa |
| (ATSOS2, CIPK24, SNRK3.11, SOS2, AT5G35410) T168A S228D construct |
was transformed into |
sos2-2 mutant |
|
| OsOSC10 loss-of-function mutants (osc10-Cr) |
were generated |
|
Oryza sativa |
| stable genetic transformation |
has been accomplished in |
bryophytes |
|
| model cyanobacteria |
is easier to carry out genetic manipulation in |
Microcystis 7806 |
Synechococcus 7942; Microcystis 7806 |
| (ATUBP5, PDE323, UBP5, AT2G40930) JAMM1, and JAMM2 |
could not be obtained as gene deletion mutants after screening |
> 100 transformants in three independent trials |
Fusarium graminearum |
| (ATSYP132, SYP132, AT5G08080) −/− homozygous mutant |
was not identified among |
CRISPR/Cas9-edited transgenic plants |
Oryza sativa |
| R2-4A mutant line |
has |
(APY2, ATAPY2, AT5G18280) knockout |
Arabidopsis thaliana |
| (DD45, EC1.2, AT2G21740) gene promoter |
drives expression of |
Cas9 |
Arabidopsis thaliana |
| tissue- and stage-specific promoters |
should be applied to overexpress |
ZmBELL10 |
|
| (AtLEC2, LEC2, AT1G28300) mutant |
introduced into |
(AGD1, VAL1, AT5G61980) (HSI2-L1, HSL1, VAL2, AT4G32010) mutant background |
Arabidopsis thaliana |
| YFP-HSC70.1M construct |
is produced in |
transgenic lines |
Arabidopsis thaliana |
| YFP(s)::HSC70.1 construct |
is produced in |
transgenic lines |
Arabidopsis thaliana |
| Implementation of CRISPRi with multiplexed sgRNAs |
may allow |
achievement of poly-deletion mutants in considerably shorter time |
|
| LmPf2 overexpression |
was performed in |
wild-type strain and KMT1 inactivated strain |
Leptosphaeria maculans |
| transgenic eggplant |
was created to |
control eggplant shoot and fruit borer (SFB, Leucinodes orbonalis Guenee, Lepidoptera: Pyralidae) |
Solanum melongena; Leucinodes orbonalis |
| miR4407-resistant version of GmIPT3 (mGmIPT3) |
has |
synonymous mutations within miR4407 binding site |
Glycine max |
| (AtbZIP16, bZIP16, AT2G35530) WT overexpressing line |
was generated in |
(AtbZIP, bZIP, AT1G68880) triple mutant background |
Arabidopsis thaliana |
| acbp3-3 CRISPR line |
was generated in |
Arabidopsis thaliana Ler-0 ecotype |
Arabidopsis thaliana |
| spores |
are routinely used for |
stable transformation studies in fungi |
|
| transgenic tomato plants constitutively overexpressing CaMYB12-like |
were produced in |
tomato cv Ponderosa background |
Solanum lycopersicum |
| transgenic soybean lines overexpressing AtME4 |
express |
AtME4 (ATNADP-ME4, NADP-ME4, AT1G79750) |
Glycine max; Arabidopsis thaliana |
| higher order transporter mutant lines in cytokinin reporter background |
can be generated by employing |
Multi-Knock toolbox |
|
| fus3-3 allele |
is |
point mutation |
Arabidopsis thaliana |
| Multi-Knock toolbox |
is designed to overcome |
functional redundancy in plants |
|
| independent hsc70.1 hsp70.4 double-mutant lines |
were produced expressing |
mobile YFP-HSC70.1 and nonmobile YFP-HSC70.1M transcripts |
Arabidopsis thaliana |
| Line hsf3-m4 |
is |
(ATHSF3, ATHSFA1B, HSF3, HSFA1B, AT5G16820) gene-edited algae strain |
Phaeodactylum tricornutum |
| two independent knockout lines of CIPK-B |
were generated using |
CRISPR/Cas9 system |
Marchantia polymorpha |
| abi3-12 mutation |
used to construct |
triple mutant |
Arabidopsis thaliana |
| 35S promoter-driven (ADF4, ATADF4, AT5G59890) (35S pro: ) construct |
is transformed into |
adf3-1 mutant |
Arabidopsis thaliana |
| strategy of combining increased gene expression and mutations in conserved amino acid residues |
was used in |
transgenic rice |
|
| trxB gene |
is disrupted by |
streptomycin/spectinomycin cassette |
Synechocystis |
| (MED8, AT2G03070) gene editing using Crispr-Cas9 |
generated |
four Phaeodactylum tricornutum lines carrying identical biallelic mutations in (MED8, AT2G03070) |
Phaeodactylum tricornutum |
| Two independent slskor knockout alleles (slskor-1 and slskor-2) |
were obtained after |
gene edition with CRISPR-Cas |
Solanum lycopersicum |
| plastid transformation |
has not yet succeeded in |
major grain and seed crops |
|
| HCO3− pumps BicA and SbtA |
require single transformations targeted at |
plastid envelope |
|
| fer-4 ; aha2-4 double mutants |
carrying |
mCitAHA2 fluorescent reporter |
Arabidopsis thaliana |
| pTrxQKm+ and pTrxQKm– |
were used to transform |
Synechocystis cells |
Synechocystis sp. PCC 6803 |
| molecular biology tools |
enable generation of |
Nannochloropsis transformants |
Nannochloropsis |
| 1598 independent transgenic T0 plants |
generated from |
genetic transformation |
Oryza sativa |
| Ceratadon purpureus |
are also amenable to |
genetic manipulation |
Ceratadon purpureus |
| C. reinhardtii |
undergoes |
nuclear transformation |
Chlamydomonas reinhardtii |
| reliable protocol for transformation of Arabidopsis plastids |
is not currently available |
chloroplast genetic engineering |
Arabidopsis thaliana |
| zinc finger nucleases |
will allow |
expression silencing constructs insertion in plant genomes |
|
| arabinofuranosidase (RsAraf1) |
was overexpressed in |
transgenic poplars |
Populus trichocarpa |
| trxQ gene |
is disrupted by |
kanamycin/spectinomycin cassette |
Synechocystis |
| marker system |
should not be retained in |
final product |
|
| ProUBQ10:GFP-VAMP711 plasmid |
was transformed into |
ost2-2D background |
Arabidopsis thaliana |
| anp triple mutant |
could not be obtained by |
crossing |
Arabidopsis thaliana |
| loss of function mutants of (AtSAM1, MAT1, METK1, SAM-1, SAM1, AT1G02500) 2, and 3 genes |
were created using |
egg cell-specific CRISPR/Cas9 system in L119 background |
Arabidopsis thaliana |
| more than 20 independent transformants |
were confirmed |
Ubi::TDC3 transgenic rice |
Oryza sativa |
| a mathematical model |
will allow identification of |
a logical sequence of gene additions to deliver progressive improvements and avoid any lethal effects |
|
| T-DNA insertion knockout lines for LPLA and (LIP2, LIP2p1, AT4G31050) |
are |
only a few available in public seed stocks |
Arabidopsis thaliana |
| STXB+/– mutant strain |
contains disrupted |
trxB gene |
Synechocystis |
| (AHA2, AtHA2, HA2, PMA2, AT4G30190) Dendra2AHA2 plants |
express |
Dendra2 fluorescent protein-tagged (AHA2, AtHA2, HA2, PMA2, AT4G30190) |
Arabidopsis thaliana |
| four-component barley stripe mosaic virus-based system |
allows |
gene cotransformation |
|
| chloroplast transformation technique |
allowed inactivation of |
plastid ndh genes ( (NDHA, ATCG01100) ndhB, (NDHC, ATCG00440) (NDHH, ATCG01110) (NDHI, ATCG01090) (NDHJ, ATCG00420) (NdhK, PSBG, ATCG00430) ) |
tobacco |
| php1,2,3 triple mutant |
created |
|
Oryza sativa |
| miR156-resistant StSPL9 OE potato plants (rSPL9 OE lines) |
are generated by introducing |
silent mutations in microRNA recognition element (MRE) |
potato |
| GAL4/UAS system |
is used for |
tissue-specific expression of dominant-negative (ACT7, AtACT7, AT5G09810) |
Arabidopsis thaliana |
| new homozygous line |
was generated by |
editing (ATHSF3, ATHSFA1B, HSF3, HSFA1B, AT5G16820) in MED8-GFP using Crispr-Cas9 |
Phaeodactylum tricornutum |
| Gmprr3b loss-of-function mutants |
were generated using |
CRISPR/Cas9 technology |
Glycine max |
| siR109944 OE plants |
were constructed by |
overexpression of siR109944 under control of 35S promoter |
Oryza sativa |
| CRISPR-mediated base-editing approach |
failed to obtain plants with T to C at position 1005, but generated plants with T to C at position 999 |
(HTD1, AT2G19540) coding sequence |
Oryza sativa |
| PpAN1-1 knockout line #6-205 |
is |
single gene knockout (SKO) line |
Physcomitrella patens |
| anti-159 plants |
led to development of |
second series of amiRNA plant expression vectors |
Arabidopsis thaliana |
| single and multiple (CDC73, PHP, AT3G22590) mutant lines |
created using |
CRISPR/Cas9 |
Oryza sativa |
| BdWRKY38-ox plants |
were produced in |
Bd21 (susceptible) background |
Brachipodium distachyon |
| (KFB20, KMD1, AT1G80440) and (KFB01, KMD2, AT1G15670) |
have matched genotype |
matched genotype |
Oryza sativa |
| maize studies |
benefit from |
genome editing protocols |
Zea mays |
| 35S::YFP-H6 and 35S::H6-YFP overexpression constructs |
were obtained as |
multiple transgenic lines |
Glycine max |
| (AtDRB1, DRB1, HYL1, AT1G09700) cDNA |
was inserted into |
binary vectors |
Arabidopsis thaliana |
| siR109944 OE lines |
were overexpressed in |
Arabidopsis using Agrobacterium-mediated floral dip method |
Arabidopsis thaliana |
| CRISPR-Cas9 technology |
used to |
knock out rice RbcS multigene family |
Oryza sativa |
| four GE rice lines |
expressed |
foreign Bt cry genes |
Oryza sativa |
| double mutant (AtLHP1, LHP1, TFL2, AT5G17690) (AtCYP71, CYP71, AT3G44600) |
was generated from |
cyp71-1 and tfl2-1 alleles |
Arabidopsis thaliana |
| FBL55 OE plants |
were constructed by |
overexpression of FBL55 under control of 35S promoter |
Oryza sativa |
| zinc finger nucleases |
will allow |
site-directed mutagenesis of endogenous plant genes |
|
| HvDhn4s promoter |
can be used for |
development of strong and drought-inducible expression system in wheat |
Triticum aestivum |
| 17 OsDof genes |
could not be mutated even after |
three independent transformation attempts |
Oryza sativa |
| use of natural elicitors as tools |
could provide route to |
non-constitutive expression of insect control genes |
|
| PpAN1-2 knockout line #42 |
is |
single gene knockout (SKO) line |
Physcomitrella patens |
| green area methods |
covers |
plant transformation |
|
| genetic engineering of single or multiple targets and quantitative trait loci |
aims to create |
commercial-grade cultivars with high-yielding potential under optimal and suboptimal conditions |
|
| GE plants |
can cause |
intended changes |
|
| attaching effective transit peptides to each carboxysome component |
may also be difficult |
transformation difficulty |
|
| OsCKX4 cDNA |
is introduced into |
wild-type rice |
Oryza sativa |
| 35S :: CHE-GFP transgenic line |
is generated |
in Arabidopsis |
Arabidopsis thaliana |
| Arabidopsis cellulase (AtCel1) |
was overexpressed in |
transgenic poplars |
Populus trichocarpa |
| new approaches |
offer promise of achieving |
gene targeting in plants |
|
| second series of amiRNAs |
was constructed in |
pBlueGreen plant expression vector |
Arabidopsis thaliana |
| ∆PpAN1-1/1-2(GFP-TUA1) #20 and #31 |
have |
single insertion of antibiotic resistance gene in PTA1 site |
Physcomitrella patens |
| CRISPR technologies and manipulation of target proteins in specific spatial or temporal settings |
overcome |
limitations of classical genetics |
|
| modular organisation |
combined with |
proof-of-concept successes in decoupling immunity from growth penalties through targeted genetic interventions |
|
| Brassica juncea |
has |
susceptibility to genetic manipulation |
Brassica juncea |
| knowledge of signaling pathways and master regulators |
will facilitate |
genetic engineering of single or multiple targets and quantitative trait loci |
|
| Agrobacterium tumefaciens cells harboring gene expression construct |
were used to generate |
transgenic hairy roots |
Glycine max |
| proof of principle for flexible late blight resistance varieties |
produced through |
cisgenesis |
Solanum tuberosum |
| CRISPR/Cas9 knockout mutations in Nipponbare GT707A3 |
generated |
12 heterozygous mutant lines in T0 generation |
Oryza sativa |
| CRISPR-Cas-based synthetic biology in plants |
circumvents |
use of potentially integrative DNA elements |
|
| viral vectors |
are expected to remain powerful tools to test |
functionality of genes and engineered circuits |
|
| modification of hormone biosynthetic pathways |
facilitates generation of |
transgenic crop plants with enhanced abiotic stress tolerance |
|
| OsTrxh2 gene knockout mutants |
were generated by |
CRISPR/Cas9 DNA editing system |
Oryza sativa |
| replacing minimal fragments with corresponding fragments of alleles from wild relatives |
would provide |
unprecedented accuracy and speed |
Solanum tuberosum |
| synonymous codons |
prevents |
possible re-binding of TALEN construct |
Phaeodactylum tricornutum |
| 17 OsDof genes without knockouts |
may have been due to |
spacer location upstream of the Dof domain |
Oryza sativa |
| triple and quadruple transformants |
were produced by transforming |
double transformant PE×PD with rice ME gene construct |
Oryza sativa |
| x1_D95N construct |
was cloned in |
pPTbsr plasmid backbone |
Phaeodactylum tricornutum |
| understanding of gene expression |
has been used to |
engineer plants |
|
| zmswi3c1 loss-of-function mutants |
could not be obtained by |
TILLING or RNA interference (RNAi) |
Zea mays |
| Lhcx4 overexpression construct |
was based on |
Lhcx4 construct used by Buck et al. (2019) |
Phaeodactylum tricornutum |
| transgene technologies |
allowed overcoming |
species barriers |
|
| knowledge of how transcription activator-like effectors bind DNA |
is leading to |
broader applications in genome engineering |
|
| CRISPR-Cas-based synthetic biology in plants |
avoids |
time-consuming and labor-intensive tissue culture processes |
|
| green area methods |
covers |
creation of populations of nearly isogenic lines (NILs) |
|
| variety of approaches |
were tested to allow |
stable transfer of genes into C. gynandra L. |
Cleome gynandra |
| pTV-NaGSNOR construct |
was prepared by inserting |
partial NaGSNOR coding sequence into pTV00 vector |
Nicotiana attenuata |
| mustard |
is very recalcitrant to |
transformation |
Sinapis alba |
| x1_D95N_E205Q construct |
was transformed in |
x1KO strain |
Phaeodactylum tricornutum |
| bryophytes |
allow homozygous mutant generation in |
3–4 weeks |
|
| (AtDRB1, DRB1, HYL1, AT1G09700) cDNA construct |
was transformed into |
(AtDRB1, DRB1, HYL1, AT1G09700) mutant plants |
Arabidopsis thaliana |
| CrFKBP12 fused to YFP behind a constitutive promoter (pRbcs/Hsp90:CrFKBP12:YFP) |
was transformed into |
Chlamydomonas cells |
Chlamydomonas reinhardtii |
| testbed plant |
enables |
rapid generation of transgenics |
|
| very high levels of foreign (PPDK, AT4G15530) expression |
hampered |
gene introduction |
Oryza sativa |
| MD×ME cross using MD-36 and ME-4 as parents |
was produced by |
crossing |
Oryza sativa |
| enrichment strategies |
can be achieved through |
transformation of cisgenes |
Solanum tuberosum |
| similar fusion |
recently used for |
tissue-specific genetic ablation |
|
| homozygous lines |
were |
selected |
Arabidopsis thaliana |
| small number of candidate genes reported for leaf traits |
are manageable targets for |
multi-locus genome editing |
Zea mays |
| gene editing of DcWRKY75 homolog genes |
may provide a strategy for |
cultivating longer vase life carnations and other ethylene-insensitive cut flowers |
|
| P. andersonii |
has |
efficient protocols for CRISPR-Cas9 genome editing |
P. andersonii |
| genes for the biosynthesis of the natural insecticidal SLMs |
are available for |
exploitation by genetic engineering |
|
| simple method |
generates transformants of |
most closely related C4 species to A. thaliana |
Cleome gynandra; Arabidopsis thaliana |
| OsRAN2 overexpressed Arabidopsis and rice plants |
were generated |
transgenic plants |
Arabidopsis thaliana; Oryza sativa |
| engineered RGA5 variants |
were incorporated into |
transgenic rice |
Oryza sativa |
| AI, including LLMs, DL, and ML |
can be applied to |
gene modification and regulation studies |
|
| pCB2004-SUE4 construct |
was transferred into |
tobacco |
Nicotiana tabacum |
| transgenic lines |
were generated using |
two inducible promoters from Arabidopsis thaliana ( (AtSAG12, SAG12, AT5G45890) and HSP18) |
Agrostis stolonifera; Arabidopsis thaliana |
| CRISPR/Cas9 technique |
may provide a strategy for |
cultivating longer vase life carnations and other ethylene-insensitive cut flowers |
|
| knockout of single NBCL gene of P. andersonii, PanNOOT1 |
made |
nbcl mutant in a tree species |
P. andersonii |
| consumption of plants loaded with bioengineered bacterial or/and viruses |
raises concerns |
transient expression systems |
|
| T0 events |
yielded |
43 transgenic plants |
Triticum aestivum |
| PEBV-based plant expression vector |
was used as |
plant gene expression vector |
Nicotiana benthamiana; Solanum lycopersicum |
| chloroplast genome (plastome) transformation techniques |
enabled |
mutagenic studies of higher plant Rubisco holoenzyme |
|
| plastome transformation |
can be performed in |
expanding range of plant species |
|
| genetic manipulation of (RBCL, ATCG00490) by plastome transformation in tobacco |
is |
routine but protracted process |
tobacco |
| (AtDRB1, DRB1, HYL1, AT1G09700) cDNA |
was inserted into |
binary vectors under the control of the cauliflower mosaic virus 35S promoter |
Arabidopsis thaliana |
| plant virus-based vectors |
do not require |
development of stable transformants |
|
| double transformant overproducing PEPC and ME (PE•ME) |
was produced by |
introduction of rice ME gene construct into PE-2 |
Oryza sativa |
| plants ectopically overexpressing (CYP96A15, MAH1, AT1G57750) under the control of the cauliflower mosaic virus (CaMV) 35S promoter |
had been generated in |
the mah1-1 background |
Arabidopsis thaliana |
| Arabidopsis thaliana |
requires |
5–6 months for homozygous mutant generation |
Arabidopsis thaliana |
| biotechnology |
has added |
new possibilities of obtaining male-sterile plants |
|
| segregation data of 3A line |
proved |
integration of single copy of silencing cassette |
Triticum aestivum |
| 5A and 44A T1 Torka lines |
had estimated number of integrated copies of |
2 |
Triticum aestivum |
| soybean |
60% are |
genetically modified (GM) |
|
| x1_motif-1 construct |
was transformed in |
x1KO strain |
Phaeodactylum tricornutum |
| control strain |
generated with |
chloramphenicol resistance gene cassette at neutral site |
Synechocystis |
| genetic engineering approaches for secondary metabolite pathways |
are more demanding than |
previously adopted genetic engineering approaches |
|
| x1_D95N construct |
was transformed in |
x1KO strain |
Phaeodactylum tricornutum |
| constitutive CaMV 35S promoter |
was used to generate |
soybean transgenic lines with GmSPX5 overexpression (i.e., OX5 and OX12) |
|
| bhlh6 (ATSPX4, SPX4, AT5G15330) double mutant |
was generated by crossing |
bhlh6-1 with (ATSPX4, SPX4, AT5G15330) |
Oryza sativa |
| hygromycin-resistant seedlings |
were analyzed for |
CRISPR editing confirmation |
Fragaria vesca |
| constitutive promoters |
are widely used in |
plant biotechnology research |
|
| plasmids |
were introduced into |
Arabidopsis (Col-0) through the floral dip method |
Arabidopsis thaliana |
| Arabidopsis 35S::ULP1-HA |
is |
experimental model organism |
Arabidopsis thaliana |
| all transformants used in this study |
had |
single transgene per haploid |
Oryza sativa |
| TDCA |
provides quantitative information which can be used to inform |
rational genetic manipulation |
|
| distantly related isoenzyme (ATSUC2, SUC2, SUT1, AT1G22710) of yeast (Saccharomyces cerevisiae) |
was not expected to interfere with |
plant antisense invertase |
|
| 35S::HYL1 transgenic plants |
were identified |
individually by PCR and Southern hybridization |
Arabidopsis thaliana |
| simple method |
generates transformants of |
NAD-ME type C4 plant |
Cleome gynandra |
| transformation efficiency |
ranged from |
0.20% to 1.40% |
Triticum aestivum |
| the present study |
by transforming |
redox-inactive variants of TRX z and (FLN1, AT3G54090) into respective Arabidopsis knockout mutant backgrounds |
Arabidopsis thaliana |
| TaCRT |
was over-expressed in |
tobacco plants |
Nicotiana benthamiana |
| co-transformed PCR-positive plants of Kontesa and Torka |
only one proved to be |
successfully co-transformed |
Triticum aestivum |
| fragment of genomic DNA of Ppc gene containing exons 8 and 9 |
is subcloned and mutagenized by |
conventional mutagenesis method |
Zea mays |
| barley |
was transformed with |
MATE genes |
barley |
| transgenic lines transformed with Pinb silencing cassette |
were obtained from |
transformation of Kontesa and Torka cultivars |
Triticum aestivum |
| transgenic lines transformed with Pina+Pinb silencing cassette |
were obtained from |
co-transformation of Kontesa and Torka cultivars |
Triticum aestivum |
| plant virus-based vectors |
have significantly short interval between |
cloning and phenotypic analysis |
|
| GaMYB2 promoter |
is a valuable tool for |
engineering cotton fibre traits |
Gossypium hirsutum |
| SlBASL promoter and CDS |
were cloned into |
level 0 MoClo part |
Solanum lycopersicum |
| site-directed mutagenesis |
is used to generate |
mutant protein constructs |
|
| CRISPR-Cas9 system |
is used for |
gene editing |
Arabidopsis thaliana |
| transfer of heterologous genes |
is |
strategy for increased accumulation of compatible solutes |
|
| empty vector pMCG |
was used as |
control |
Triticum aestivum |
| tobacco |
has |
highest transformation efficiency |
tobacco |
| transgenic approach |
was used to |
alter the level of extensins in plant cell walls |
|
| Full-length coding sequence of SlERF.C1 |
was amplified and inserted into |
the pGreenII 62SK plasmid as the effector |
Solanum lycopersicum |
| deciphering metabolic pathways of (E)-2-decenal |
could open up |
possibility of genetic engineering of (E)-2-alkenal-producing crops |
|
| Line mhsf3-1/m8-2 |
is |
med8hsf3 double-mutant line |
Phaeodactylum tricornutum |
| (ATHPA1, EMB2196, HISN6A, HPA1, AT5G10330) 10–42 |
is expressed in |
transgenic wheat lines |
Triticum aestivum |
| pinCPromCit construct |
was targeted to |
carbonic anhydrase-citrine tagged locus |
Physcomitrella patens |
| CRISPRi silencing mediated by dCas9 |
has been used for |
engineering biotechnologically desirable traits |
|
| CRISPR/ (CaS, AT5G23060) tools |
enable |
precise genetic modifications of target genes |
|
| artificial siPEPs (a-siPEPs) of LATE ELONGATED HYPOCOTYL (LHY, LHY1, AT1G01060) |
were transformed into |
Arabidopsis thaliana |
Arabidopsis thaliana |
| AtARC1 (Arabidopsis thaliana artificial ring chromosome 1) |
is |
promising vector |
Arabidopsis thaliana |
| homologous recombination |
was used to insert |
selectable npt II marker cassette into PPR_65 |
Physcomitrella patens |
| transplastomic tomato plants expressing GFP from (PSBA, ATCG00020) promoter with T7g10 5′–UTR |
did not develop |
mutant phenotype |
Solanum lycopersicum |
| YFP-SVR construct |
is produced in |
transgenic lines |
Arabidopsis thaliana |
| gene coding for the insecticidal Cry1Ac protein from Bacillus thuringiensis (Bt) |
is incorporated into |
transgenic eggplant |
Solanum melongena; Bacillus thuringiensis |
| transgenic soybean lines overexpressing AtME2 |
express |
AtME2 (NAD-ME2, AT4G00570) |
Glycine max; Arabidopsis thaliana |
| LmPf2 inactivation via CRISPR-Cas9 |
was performed in |
wild-type strain and KMT1 inactivated strain |
Leptosphaeria maculans |
| mhsf3/MED8-GFP line |
is |
new homozygous line |
Phaeodactylum tricornutum |
| transgenic Arabidopsis plants expressing VvMYBPAR |
were generated to |
express VvMYBPAR |
Arabidopsis thaliana |
| starch molecular structures |
can be bioengineered in the plant using |
mutagenesis and transgene technologies |
|
| 35S::MYC2 transgenic plants |
were generated |
by overexpression of (ATMYC2, JAI1, JIN1, MYC2, RD22BP1, ZBF1, AT1G32640) cDNA |
Arabidopsis thaliana |
| multiple RbcS copies in the nucleus |
essentially precludes |
RbcS from targeted mutagenic or replacement strategies |
|
| SlNAGS1 over-expression |
resulted in |
stable homozygous transformants |
Arabidopsis thaliana |
| genetic transformation |
is fundamental to |
wheat molecular genetics and improvement |
Triticum aestivum |
| plastid stroma-localized dsRED marker pRecARED |
was constructed and introduced into |
wild-type and msl2-1; msl3-1 plants |
Arabidopsis thaliana |
| NTRC-R-GECO1 and AKDE1-R-GECO1 plasmids |
were cloned into |
SpeI-ApaLI linearized vector pGPTVII-Bar-U-RGECO1 |
Arabidopsis thaliana |
| full genomic fragment |
is cloned into |
pDONR221 |
|
| pWUSpro::Ypet-N7 plasmid |
is transformed into |
(CRN, SOL2, AT5G13290) mutant background |
Arabidopsis thaliana |
| Gateway cloning |
is |
DNA construct assembly technique |
Arabidopsis thaliana |
| third allele, Mpo-mr-13-1 lof |
contained |
393 bp deletion of complete predicted hairpin structure |
Marchantia polymorpha |
| pGWB235 vector |
is used for |
promoter cloning |
Arabidopsis thaliana |
| Arabidopsis proBZR1::BZR1-GFP |
is |
experimental model organism |
Arabidopsis thaliana |
| ML1::mCherry-RCI2A BRXL2::BRXL2-YFP R2D2 (RPS5A::DII-n3xVenus RPS5A::mDII-ntdTomato) line |
was generated by |
crossing |
Arabidopsis thaliana |
| (AtNIK3, CIK1, NIK3, AT1G60800) gene |
is target of |
CRISPR-Cas9 mutagenesis |
Arabidopsis thaliana |
| In-Fusion Advantage PCR Cloning Kit |
is used for |
DNA cloning |
|
| site-directed mutagenesis |
generated |
kinase-dead version of Mp PBLa |
|
| progeny seeds |
were selected with |
hygromycin antibiotic |
Arabidopsis thaliana |
| Arabidopsis Col-0 plants |
were transformed through |
floral dipping method |
Arabidopsis thaliana |
| pCRNpro::Ypet-N7 plasmid |
is constructed by |
LR recombination |
|
| modern techniques |
allow |
extensive manipulations necessary for introduction of complex processes such as carbon-concentrating mechanism |
|
| Antirrhinum majus |
was transformed with |
RNAi-DEF construct |
Antirrhinum majus |
| optimization of the promoters of both recombinases |
could greatly enhance |
targeting frequency at the moment of the transformation/integration event itself |
Arabidopsis thaliana |
| ScFRK1 cDNA |
was used to generate |
transgenic plants carrying ScFRK1 sense or antisense construct |
Solanum chacoense |
| knockin of fluorescent proteins at the endogenous locus |
using techniques such as internal tagging in organisms capable of |
high rates of homologous recombination |
Physcomitrella patens |
| level 0 vector constructs |
were further subcloned into |
level 1 or 2 binary constructs |
|
| JH4 entry vector |
was incorporated into |
binary vector JH19 |
Fragaria vesca |
| embryogenic callus cells |
is used for |
genetic transformation |
|
| modification of photosynthetic components |
can only be achieved through |
genetic manipulation |
|
| introducing BicA and other HCO3− transporters |
could be achieved by nuclear transformation and inclusion of chloroplast envelope-targeting sequences |
genetic engineering method |
|
| transgenic barley plants expressing (ATCKX1, CKX1, AT2G41510) or (ATCKX2, CKX2, AT2G19500) |
were generated using |
Agrobacterium tumefaciens-mediated transformation |
Hordeum vulgare |
| 6His (H) and tobacco etch virus protease cleavage site (T) tags |
added at |
5′-end of each Ub (U) moiety |
|
| transgenic plants expressing genes for production of unusual fatty acids |
produce seeds with |
only a fraction of the amount of the particular fatty acids seen in gene donor plants |
|
| tobacco lines |
were further bred for |
homozygous lines |
Nicotiana tabacum |
| assembly and functional annotation of Chlorella vulgaris 211/11P genome |
potentially enabled application of |
genome-editing technologies in this species |
Chlorella vulgaris |
| Arabidopsis (BIK1, AT2G39660) (PBL1, AT3G55450) mutant |
transformed with |
Mp PBLa under the control of the native AtBIK1 promoter |
Arabidopsis thaliana |
| seven independent FveSALAD-OE lines |
were obtained |
from 35S::FveSALAD transformation |
Arabidopsis thaliana |
| JH23-FveSALAD vector |
contains |
FveSALAD coding region |
Fragaria vesca |
| single transformations of BicA and SbtA targeted at plastid envelope |
should be relatively easy |
transformation difficulty |
|
| seven stress-responsive genes ( (ATCBF3, CBF3, DREB1A, AT4G25480) (ATSOS2, CIPK24, SNRK3.11, SOS2, AT5G35410) (ATNCED2, NCED2, AT4G18350) NPK1, (ABA3, ACI2, ATABA3, AtLOS5, GIN5, LOS5, SIR3, AT1G16540) (STZ, ZAT10, AT1G27730) (AT-NHX1, ATNHX, ATNHX1, NHX1, AT5G27150) ) |
transformed into |
rice cultivar Zhonghua 11 |
Oryza sativa |
| STXQB double mutant strain |
lacks |
trxB and trxQ genes |
Synechocystis |
| cik4-3 mutant |
is generated in |
Col-0 background |
Arabidopsis thaliana |
| triple Gateway recombination reaction |
is used for |
multi-gene construct assembly |
|
| coding regions of MpRBOH1 and MpPBLa |
were cloned into |
GreenGate entry vector pGGC |
|
| SALAD promoter and FveCUC2a promoter |
were assembled into |
pMDC162 vector |
Fragaria vesca |
| floral-dipping method |
is used for |
plant genetic transformation |
Arabidopsis thaliana |
| HTR2::CDT1a-RFP ML1::YFP-RCI2A line |
was generated by introducing |
HTR2::CDT1a-RFP into the ML1::YFP-RCI2A background |
Arabidopsis thaliana |
| level 2 |
was sub-cloned into |
pAGM4723 binary vector |
Solanum lycopersicum |
| (DROP1, LRL1, AT2G24260) (DROP2, LRL2, AT4G30980) /+ plants carrying DUO1-RFP |
were generated |
transgenic plants |
Arabidopsis thaliana |
| JH19-SALADg1g2 construct |
contains |
gRNA1 and gRNA2 |
Fragaria vesca |
| VCLPUFA-producing transgenic Brassica juncea |
is |
generated organism |
Brassica juncea |
| Nicotiana tabacum |
is considered to be |
ideal model plant for the study of genetic engineering |
Nicotiana tabacum |
| Arabidopsis 35S::BZR1K280/320R-GFP |
is |
experimental model organism |
Arabidopsis thaliana |
| pKannibal construct |
is subcloned into |
pART27 binary vector |
Arabidopsis thaliana |
| double Gateway reaction |
is used for |
two-gene construct assembly |
|
| Mp PBLa or Mp RBOH1 variants |
were cloned into |
level 0 vector pUAP4 |
|
| Golden Gate system |
used to generate |
expression constructs |
Arabidopsis thaliana |
| CRE and INT expression cassettes |
flanked with |
directly oriented site-specific recombination sites other than loxP sites |
Arabidopsis thaliana |
| steroid-inducible version of (PLT2, AT1G51190) under control of (AIL6, PLT3, AT5G10510) promoter |
is introduced into |
(AIL6, PLT3, AT5G10510) plt5-2 (AIL7, PLT7, AT5G65510) mutants |
Arabidopsis thaliana |
| Agrobacterium tumefaciens GV3103 |
was used for |
plant transformation |
Arabidopsis thaliana |
| tagged constructs |
were assembled into |
destination vector pGGHEK |
|
| 35S pro:GFP-STF1 and 35S pro:GFP-STF2 overexpression vectors |
are constructed by |
cloning coding DNA sequences into pTF101 vector |
Glycine max |
| CRISPR-TSKO expressing fluorescently tagged Cas9 exclusively in the root cap |
is combined with |
guide RNAs (gRNAs) targeting (ATEBP1, ATG2, EBP1, G2p, AT3G51800) or (APG5, ATATG5, ATG5, AT5G17290) |
Arabidopsis thaliana |
| pBIB-BASTA-GWR-YFP vector |
is used for |
plant transformation |
Arabidopsis thaliana |
| transformation of the mitochondrial genome |
is |
feasible |
Chlamydomonas reinhardtii |
| site-specific mutations in (ATEIN2, CKR1, EIN2, ERA3, ORE2, ORE3, PIR2, AT5G03280) |
generated by |
CRISPR-editing |
Arabidopsis thaliana |
| 46 T1 transformants |
raised and analyzed |
46 T1 transformants |
Arabidopsis thaliana |
| fusing in-frame protein with aptamer |
is not necessarily required |
genetic manipulation of aptamer |
Oryza sativa |
| CALTPI transgene |
introduced into |
Arabidopsis ecotype Col-0 |
Arabidopsis thaliana |
| PEBV |
has already been developed as |
expression vector for reporter gene GFP |
Nicotiana benthamiana |
| (ANY1, AtCESA1, CESA1, RSW1, AT4G32410) -10 mutant |
introduced into |
(AGR, AGR1, ATPIN2, EIR1, MM31, PIN2, WAV6, AT5G57090) ::PIN1-HA; background |
Arabidopsis thaliana |
| two loss-of-function (lof) mutant alleles in Mp PHY |
were generated using |
CRISPR-Cas9 |
Marchantia polymorpha |
| strain YP890 |
is derivative of |
AXT3K |
Saccharomyces cerevisiae |
| (HTU)6 |
ligated with |
two UBQ promoters |
|
| sRNAs in homo-grafting |
are particularly used in |
genetic engineering |
|
| (AtRLP10, CLV2, AT1G65380) gene |
is target of |
CRISPR-Cas9 mutagenesis |
Arabidopsis thaliana |
| (YUC, YUC1, AT4G32540) coding sequence |
is amplified from |
Arabidopsis Col-0 cDNA |
Arabidopsis thaliana |
| A-230G transgenic plants |
carry |
Col (AGL25, FLC, FLF, RSB6, AT5G10140) with single point A to G mutation at SNP−230 |
Arabidopsis thaliana |
| SALADpro::GUS construct |
was transformed into |
YW5AF7 |
Fragaria vesca |
| two 15 nt gRNAs targeting AtFT promoter |
were ligated to |
gRNA expression vectors |
Arabidopsis thaliana |
| pBIB-BASTA-35S-GWR-YFP vector |
is used for |
plant transformation |
Arabidopsis thaliana |
| Physcomitrella patens |
has |
intrinsically efficient gene targeting |
Physcomitrella patens |
| plasmid pUG36ΔGFP |
lacks |
genes encoding phiLOV2.1 or GFP |
|
| primary lines |
are used as |
standard part |
Arabidopsis thaliana |
| transformed lines |
are selected on |
kanamycin |
Arabidopsis thaliana |
| pENTRY L1-SlABCG42-L2 |
was recombined with |
pMDC43 destination vector |
Arabidopsis thaliana |
| Golden Gate Assembly Mix |
is used for |
multi-part DNA assembly |
|
| (ATPGMP, PGM, PGM1, STF1, AT5G51820) (Glyma.18g117100) or STF2 (Glyma.08g302500) coding DNA sequences |
are amplified by |
PCR using cDNA derived from Wm82 |
Glycine max |
| engineer increased amino acid content |
can be accomplished using |
transgenic approaches |
|
| T-DNA mutagenesis |
was used to introduce |
second site mutations in the acd6-1 background |
Arabidopsis thaliana |
| Greengate cloning kit |
is used for |
assembly of (ATPAP10, PAP10, PUP1, AT2G16430) pro::RCI2A–tdTomato binary plasmid |
Arabidopsis thaliana |
| LR reaction |
is used for |
gene cloning |
|
| YFP-HSC70.1M ΔSVR construct |
is produced in |
transgenic lines |
Arabidopsis thaliana |
| knockin of fluorescent proteins at the endogenous locus in organisms with high homologous recombination |
can open |
new avenues of research |
Physcomitrella patens |
| aha2-4 insertional knockout mutant plants |
transformed with |
(AHA2, AtHA2, HA2, PMA2, AT4G30190) genomic construct containing mCitrine fluorescent tag |
Arabidopsis thaliana |
| Physcomitrella patens |
has |
efficient gene targeting |
Physcomitrella patens |
| (FUS3, AT3G26790) mutant |
introduced into |
(AGD1, VAL1, AT5G61980) (HSI2-L1, HSL1, VAL2, AT4G32010) mutant background |
Arabidopsis thaliana |
| triple xxt3xxt4xxt5 mutant Arabidopsis |
generated using |
CRISPR-Cas9 technology |
Arabidopsis thaliana |
| Line m8-4 |
is |
(MED8, AT2G03070) gene-edited algae strain |
Phaeodactylum tricornutum |
| (AtbZIP16, bZIP16, AT2G35530) C358L overexpressing line |
was generated in |
(AtbZIP, bZIP, AT1G68880) triple mutant background |
Arabidopsis thaliana |
| three homozygous med8hsf3 double-mutant lines |
were generated by |
editing (ATHSF3, ATHSFA1B, HSF3, HSFA1B, AT5G16820) in the m8-2 mutant using Crispr-Cas9 |
Phaeodactylum tricornutum |
| genetic interactions of (ABI3, AtABI3, SIS10, AT3G24650) (L1L, NF-YB6, AT5G47670) and (AtLEC1, EMB 212, EMB212, LEC1, NF-YB9, AT1G21970) as partial suppressors of the embryonic seedling phenotype |
dissected by making |
series of quadruple mutants with pairwise combinations of abi3-6 with (L1L, NF-YB6, AT5G47670) and (AtLEC1, EMB 212, EMB212, LEC1, NF-YB9, AT1G21970) in the (AGD1, VAL1, AT5G61980) (HSI2-L1, HSL1, VAL2, AT4G32010) background |
Arabidopsis thaliana |
| transient transformation methods |
were limited to |
heterologous expression in gametophytes |
|
| Pseudomonas syringae DC3000 poly-mutant strain (DC3000D28E) |
required |
4 yr of experimentation |
Pseudomonas syringae |
| synthetic biology and genome editing |
will help |
maize adaptation to higher plant density |
|
| Jamm1 mutant |
could not be obtained |
mutant generation |
Fusarium graminearum |
| (L1L, NF-YB6, AT5G47670) mutant |
introduced into |
(AGD1, VAL1, AT5G61980) (HSI2-L1, HSL1, VAL2, AT4G32010) mutant background |
Arabidopsis thaliana |
| gRNA1 (GATCCAAGGTGCCTCGTCTG) and gRNA2 (GATGTTTAGAAGCATGAGGGG) |
were inserted into |
JH4 entry vector |
Fragaria vesca |
| pEntry vector |
is used for |
gene cloning |
|
| plastid transformation |
is a better option than nuclear transformation |
nuclear transformation |
|
| introducing proteins |
allows avoidance of |
need to remove protein-encoding DNA fragments from engineered plant genome |
|
| Cre protein delivery |
did not introduce |
additional selectable marker genes |
Zea mays |
| MdBT2 |
was transformed ectopically into |
mutant (ATBT2, BT2, AT3G48360) |
Arabidopsis thaliana |
| efficient silencing of up to 16 genes from the TALE family using a single sgRNA |
is more efficient than |
obtention of the equivalent poly-deletion mutant strain through sequential mutagenesis of each individual tale gene |
Xanthomonas |
| site mutations and chimera constructs |
were generated using |
previously described methods |
|
| certain varieties such as Zhonghua 11 and Hwarang in rice and C01 in maize |
are popular as recipients for |
transformation |
Oryza sativa; Zea mays |
| CRISPR-Cas9 technology |
was used to |
generate single, double, and triple mutants among (XXT3, AT5G07720) (XXT4, AT1G18690) and (XXT5, AT1G74380) |
Arabidopsis thaliana |
| Line med8-2/HSF3-GFP-3# |
is |
(MED8, AT2G03070) /HSF3-GFP-3# mutant line |
Phaeodactylum tricornutum |
| (CYP75B1, D501, TT7, AT5G07990) gene |
was chosen as target to generate |
CRISPR-edited plants |
Arabidopsis thaliana |
| genetic engineering for disease resistance |
can facilitate |
interspecific transfer of resistance genes |
|
| genetically modified (GM) crops |
perceived as |
gene revolution in agriculture |
|
| improvements to transformation |
will make it easier to deliver |
large constructs into wheat genome |
Triticum aestivum |
| biofortification |
is |
application of genetic engineering |
|
| (AtCAPE9, ATPR1, PR 1, PR1, AT2G14610) and PR1a promoters |
were cloned and fused to |
the firefly LUC reporter plasmids along with renilla luciferase (REN) driven by the Mini 35S promoter as control |
Solanum lycopersicum |
| Line mhsf3-3/m8-2 |
is |
med8hsf3 double-mutant line |
Phaeodactylum tricornutum |
| transient transformation methods |
have been developed in |
Pteris vittata |
Pteris vittata |
| stable transformation studies |
have not been reported in |
cv C-fern |
Ceratopteris richardii |
| (ATHSF3, ATHSFA1B, HSF3, HSFA1B, AT5G16820) gene editing using Crispr-Cas9 |
generated |
four homozygous Phaeodactylum tricornutum lines carrying mutations in (ATHSF3, ATHSFA1B, HSF3, HSFA1B, AT5G16820) |
Phaeodactylum tricornutum |
| CRISPR/Cas9 double-knockout transformation approach |
was used to target |
orthologous genes of (CYP86, CYP86A1, HORST, AT5G58860) and (CYP86B1, AT5G23190) |
Populus × canescens |
| abi3-6 allele |
is |
deletion mutation |
Arabidopsis thaliana |
| Jamm2 mutant |
could not be obtained |
mutant generation |
Fusarium graminearum |
| Pro 35S : AtRPL10s-GFP constructs |
were generated in |
Arabidopsis transgenic plants |
Arabidopsis thaliana |
| Line med8-1/HSF3-GFP-3# |
is |
(MED8, AT2G03070) /HSF3-GFP-3# mutant line |
Phaeodactylum tricornutum |
| (PYL9, RCAR1, AT1G01360) (PYL10, RCAR4, AT4G27920) double mutants |
were generated by |
CRISPR/Cas9-mediated genome editing |
|
| use of genome editing tools for site-specific insertion of transgenes |
promotes |
adoption in a combined strategy |
|
| combination of (PSBA, ATCG00020) promoter with T7g10 or 5′–UTR |
results in |
entirely normal phenotype |
Solanum lycopersicum |
| de novo formation of maize artificial chromosomes by particle bombardment |
has been reported in |
maize |
Zea mays |
| double mutant plants |
were transformed with |
(ATCDS1, CDS1, AT1G62430) or (CDS2, AT4G22340) cDNA under the control of the XVE-Olex-46 promoter system |
Arabidopsis thaliana |
| 11-kb DNA fragment harboring a single coding sequence, the Vat-resistant allele with its native promoter and terminator |
was introduced via |
Agrobacterium-mediated transformation |
Cucumis melo |
| future polycistronic operons |
will usher in |
new age of plastid synthetic biology |
|
| loose cluster bunch trait |
can be introduced into other cultivars using |
CRISPR-Cas9 technology |
Vitis vinifera |
| (54CP, CPSRP54, FFC, SRP54CP, AT5G03940) and other members of the CpSRP pathway |
have been suggested to be |
suitable universal targets for gene editing |
Chlamydomonas reinhardtii |
| (54CP, CPSRP54, FFC, SRP54CP, AT5G03940) and other members of the CpSRP pathway |
are suitable for gene editing with the purpose of |
minimizing the chlorophyll antenna size in microalgae |
Chlamydomonas reinhardtii |
| lack of efficient regeneration and transformation protocol for moso bamboo |
prevents availability of |
DNA methyltransferase mutants |
moso bamboo |
| zinc-finger nuclease technology |
can modify |
coding regions, introns, promoters, or 3' UTRs |
Chlamydomonas reinhardtii |
| (CESA6, E112, IXR2, PRC1, AT5G64740) -1 mutant |
introduced into |
(AGR, AGR1, ATPIN2, EIR1, MM31, PIN2, WAV6, AT5G57090) ::PIN1-HA; background |
Arabidopsis thaliana |
| separate clv1-11 pCLV1::CLV1-2×GFP line |
introgressed into |
clv1-11 clv3-2 background |
Arabidopsis thaliana |
| pWOX4::mVenus-MBD construct (pXL12) |
contains modules |
WOX4pro(A), B-dummy(B), mVenus(C), MBD(D), (WOX4, AT1G46480) terminator(E) and hygromycinR(F) |
Arabidopsis thaliana |
| artificial siPEPs (a-siPEPs) of AGAMOUS (AG) |
were transformed into |
Brachypodium |
Brachypodium |
| pENTR/D-MCS vector |
contains |
multiple cloning site |
|
| RNAi-DEF lines |
were obtained through |
highly reliable transformation protocol |
Antirrhinum majus |
| chimeric expression cassette with orf182 |
was transferred into |
Yuetai B (YB) |
Oryza sativa |
| pennycress |
is amenable to |
Agrobacterium-mediated floral dip transformation |
Thlaspi arvense |
| TaGW2-B1 mutants |
can be created using |
efficient transgene-free gene editing methods |
Triticum aestivum |
| StPHYF-RNAi construct |
transformed into |
E109 plants |
Solanum tuberosum |
| promoter and UTR elements that trigger high transgene expression levels in non-green edible tissues |
are of great value for |
high-level production of recombinant proteins in chromoplast-containing fruits and tap roots |
|
| selectable marker |
could also be excised in this manner to obtain |
final marker-free T–DNA integration event |
Arabidopsis thaliana |
| The GFP-toxin B and toxin B-YFP expressing plants |
had |
20 and 8 independent T1 mature plants |
Arabidopsis thaliana |
| VirE2-GFP fusion construct |
was used to replace |
virE2 gene of A348 |
Agrobacterium tumefaciens |
| Trifolium alexandrinum L. |
was transformed with |
Arabidopsis HARDY gene |
Trifolium alexandrinum; Arabidopsis thaliana |
| R genes combined at single locus |
ensures that |
stack remains intact in downstream breeding programs |
Triticum aestivum |
| additional single-copy target lines |
to obtain a clear view of |
efficiency of the proposed SSI method |
Arabidopsis thaliana |
| model strain |
contains |
non-functional aminoglycoside 3′-phosphotransferase VIII (aphVIII) selection marker |
Chlamydomonas reinhardtii |
| zinc-finger nuclease technology |
is of special interest for |
advances in Chlamydomonas research and biotechnological applications |
Chlamydomonas reinhardtii |
| pOp6/LhGR system |
could be applied for field experiments with |
other transformable plant species like petunia, peanut or rice |
Petunia; Arachis hypogaea; Oryza sativa |
| Overexpression dominant negative GFP-Rop4 |
had eight independent lines |
transgenic lines |
Arabidopsis thaliana |
| OX constitutively active GFP-Rop4 seedlings |
had |
three lines |
Arabidopsis thaliana |
| H2UL-1 transgenic line |
was created by introducing |
HTC2-pUbq10-Ω-Kozak::LUC construct |
Arabidopsis thaliana |
| Gmcry1c d4 mutant |
is |
CRISPR-Cas9 knockout mutant |
Glycine max |
| (CIK4, AT5G45780) gene |
is target of |
CRISPR-Cas9 mutagenesis |
Arabidopsis thaliana |
| pENTR-D topo vector |
is used for |
(YUC, YUC1, AT4G32540) CDS cloning |
|
| inactive resistance genes from susceptible varieties |
could be repaired by |
replacing minimal fragments with corresponding fragments of alleles from wild relatives |
Solanum tuberosum; Solanum species |
| extra hurdles associated with the need to infect the plants to deliver the selected constructs |
appear as important limitations of |
available transient expression systems |
|
| bHLH6 OV and (ATSPX4, SPX4, AT5G15330) OV double overexpression lines |
were developed by crossing |
bHLH6 OV with (ATSPX4, SPX4, AT5G15330) OV |
Oryza sativa |
| insect-targeted RNA interference (RNAi) constructs |
expressed in |
transgenic plants |
|
| future developments for efficient delivery of DNA/RNA sequences and proteins into plant tissues without bacterial or viral vectors |
may solve |
limitations of available transient expression systems |
|
| LB-loxP-RB footprints |
should be removed from |
final recombinant |
Arabidopsis thaliana |
| stacking of multiple transgenes at a predicted site of integration |
allows |
control of the position in the genome |
Arabidopsis thaliana |
| engineered Camelina lines with altered seed oil compositions |
are rapidly achievable through |
Agrobacterium tumefaciens-mediated, floral-dip transformation method |
Camelina sativa |
| Line hsf3-m3 |
is |
(ATHSF3, ATHSFA1B, HSF3, HSFA1B, AT5G16820) gene-edited algae strain |
Phaeodactylum tricornutum |
| (AtLEC1, EMB 212, EMB212, LEC1, NF-YB9, AT1G21970) (L1L, NF-YB6, AT5G47670) and (AtLEC2, LEC2, AT1G28300) alleles |
are |
transfer DNA insertion mutants |
Arabidopsis thaliana |
| maize Ubiquitin (Ubi) promoter-driven expression of rice TDC3 overexpression construct (Ubi::TDC3) |
was introduced into |
wild-type cv Wuxiangjing 9 |
Oryza sativa |
| coding regions of genes analyzed |
amplified and cloned upstream of |
dsRed sequence |
|
| galactanase (Tv6GAL) |
was overexpressed in |
transgenic poplars |
Populus trichocarpa |
| transformation technology for moso bamboo |
is not yet available |
moso bamboo |
moso bamboo |
| algal CCM |
is |
attractive target for transfer |
|
| a mathematical model |
was used to determine |
a possible sequence of gene additions that would give an incremental improvement |
|
| chemically inducible C3′H expression construct |
transformed into |
reduced epidermal fluorescence8 (CYP98A3, REF8, AT2G40890) mutant |
Arabidopsis thaliana |
| a random sequence of gene stacking |
would likely be |
inefficient |
|
| some CCM components |
may prove more difficult to introduce than others |
transformation difficulty |
|
| achieving full benefit of cyanobacterial carbon-concentrating mechanism (CCM) |
will be considerably more challenging and most probably will depend on |
plastid transformation for expression of shell proteins and Rubisco isoform |
|
| flv4-2 operon |
was integrated into the chromosome by replacement of |
psbA2 gene |
Synechocystis |
| stability problem of down-regulation |
can be overcome by |
making stable ccr mutants using CRISPR/Cas9 genome-engineering technique |
Populus spp. |
| STXQ+/– mutant strain |
contains disrupted |
trxQ gene |
Synechocystis |
| homozygous knockout of LPLA or (LIP2, LIP2p1, AT4G31050) |
demonstrates that plants cannot tolerate |
deletion of either enzyme |
Arabidopsis thaliana |
| transgenic lines and their nontransgenic counterparts |
would be |
near-isogenic lines differing in one or two genes |
|
| protoplasting of Tortula |
thus prevents |
transformation |
Tortula |
| (AtbZIP16, bZIP16, AT2G35530) C330L overexpressing line |
was generated in |
(AtbZIP, bZIP, AT1G68880) triple mutant background |
Arabidopsis thaliana |
| the addition of some genes |
may be |
simply unnecessary |
|
| pBC34S plasmid |
was used to transform |
Synechocystis STXB cells |
Synechocystis |
| glass bead method |
is used for |
nuclear transformation of C. reinhardtii |
Chlamydomonas reinhardtii |
| ability to make improvements using transgenic approaches |
should soon be possible |
in pennycress |
Thlaspi arvense |
| transposons |
have become |
valuable tools for genetic manipulation |
|
| bhlh6 knockout mutants |
were generated via |
CRISPR/Cas9 |
Oryza sativa |
| transcription factor couple from Antirrhinum |
was introduced in |
tomato |
Solanum lycopersicum |
| 35S::MdBT2-ovx and 35S::MdBT2-anti constructs |
were transformed into |
35S::MdMYB1-GFP transgenic calli |
Malus domestica |
| (ATPDX1, ATPDX1.3, PDX1, PDX1.3, RSR4, AT5G01410) mutant |
was transformed with |
chimeras of promoter region fused to (ATPDX1, ATPDX1.3, PDX1, PDX1.3, RSR4, AT5G01410) or .1 coding region |
Arabidopsis thaliana |
| new expression system |
provides |
outstanding tool for genetic and metabolic engineering of microalgae |
Nannochloropsis oceanica |
| Lyu et al. (2023) |
used |
development of custom gene-edited mutants |
Glycine max |
| P. patens |
has amenability to |
gene targeting |
Physcomitrella patens |
| Aspergillus xyloglucanase (AaXEG2) |
was overexpressed in |
transgenic poplars |
Populus trichocarpa |
| Physcomitrella patens |
is easily |
transformed |
Physcomitrella patens |
| pTrxBSp+ and pTrxBSp– |
were used to transform |
WT Synechocystis cells |
Synechocystis sp. PCC 6803 |
| protocol for transformation of Arabidopsis plastids |
would enable |
mutation of features and testing their influence on pausing and protein assembly |
Arabidopsis thaliana |
| R2-4A mutant line |
has |
estradiol-inducible (APY1, ATAPY1, AT3G04080) suppression |
Arabidopsis thaliana |
| aco quadruple mutant |
generated by |
genetic crossing of Arabidopsis aco T-DNA insertion lines |
Arabidopsis thaliana |
| CRISPR–Cas9-mediated genome-edited lines in rice variety Nipponbare |
were generated |
Osecs-1 and Osces-2 lines |
Oryza sativa |
| host-induced gene silencing (HIGS) |
has been used to |
silence putative effector RirG110290 called (AtCTR1, CTR1, SIS1, AT5G03730) |
Rhizophagus irregularis |
| soybean reference assembly |
has been used for |
precision gene editing |
Glycine max |
| x1_W133M transformed lines |
showed |
integration of construct |
Phaeodactylum tricornutum |
| sll0545 disruption |
could not be obtained |
desired transformant |
Synechocystis |
| enrichment strategies |
can be achieved through |
novel gene editing tools |
Solanum tuberosum |
| green area methods |
covers |
genome editing |
|
| determination of biochemical and kinetic properties of mimosine-degrading enzyme |
may be useful in |
developing transgenic Leucaena leucocephala with reduced mimosine content |
Leucaena leucocephala |
| OsmiR396d-resistant OsGRF4 and OsGRF6 alleles |
can convert |
C to T in OsmiR396 targeted DNA regions |
Oryza sativa |
| YFP-HSC70.1 ΔSVR deletion variant |
is produced in |
transgenic lines |
Arabidopsis thaliana |
| T. pseudonana |
has |
expanding and sophisticated toolbox for genetic manipulation |
Thalassiosira pseudonana |
| Line m8-3 |
is |
(MED8, AT2G03070) gene-edited algae strain |
Phaeodactylum tricornutum |
| three homozygous mutant lines |
were generated by |
editing (MED8, AT2G03070) in the HSF3- overexpression line HSF3-GFP-3# |
Phaeodactylum tricornutum |
| (ABI3, AtABI3, SIS10, AT3G24650) mutant |
introduced into |
(AGD1, VAL1, AT5G61980) (HSI2-L1, HSL1, VAL2, AT4G32010) mutant background |
Arabidopsis thaliana |
| OE-VAMP711-15 crossed into ost2-2D genetic background |
produces |
ost2-2D-OE-VAMP711 plants |
Arabidopsis thaliana |
| pTrxBSp+ and pTrxBSp– |
were used to transform |
STXQ mutant Synechocystis cells |
Synechocystis sp. PCC 6803 |
| pCsFAD3:GUS transgenic plants |
were generated by |
transformation into Suneson wild-type plants |
Camelina sativa |
| enzymes producing various unusual fatty acids |
have been cloned and expressed in |
transgenic plants |
|
| silenced lines |
were independently complemented with |
each MED7 paralog using conditional expression system |
Arabidopsis thaliana |
| abi3-12 mutation |
is |
nonsense mutation |
Arabidopsis thaliana |
| Gmcry2c d4 mutant |
is |
CRISPR-Cas9 knockout mutant |
Glycine max |
| very long chain fatty acids (>C20) |
has |
transgenic plants producing them |
|
| SWAM1-OE line |
was developed by |
overexpressing the full-length coding region under the maize ubiquitin promoter |
Brachypodium distachyon |
| potential targets for biotechnological manipulation of Chlorella vulgaris |
for transferring specific Chlorella vulgaris 211/11P properties to |
other species |
Chlorella vulgaris |
| ZmPOD65 missense mutation at amino acid (aa) 73 causing a change from Met to Leu |
is one of |
two independent ZmPOD65 mutations |
Zea mays |
| 11 Arabidopsis CLEs with known repressive activity |
were simultaneously mutated using |
multiplex CRISPR/Cas9 |
Arabidopsis thaliana |
| Gmcry2a d9 mutant |
is |
CRISPR-Cas9 knockout mutant |
Glycine max |
| selection of suitable targets |
is crucial to |
design of successful GE (genetic engineering) experiments |
|
| 35S::GFP-BASL-IC lines |
were created using |
the construct reported in reference 13 |
Arabidopsis thaliana |
| BASL::MYR-BRX-YFP and basl-2 35S::PIP2A-RFP lines |
were transformed with |
ML1::H2B-YFP |
Arabidopsis thaliana |
| pMOA33 binary vector backbone |
is used as |
plasmid construction |
|
| putative transgenic plants |
are characterized using |
leaf painting with basta solution, qPCR analysis, and DNA sequencing |
Glycine max |
| lycophyte model |
is not prone to |
transformation |
|
| injection buffer |
is used for |
Agrobacterium infiltration |
Nicotiana benthamiana |
| construction of higher-order mutants |
is |
exceedingly difficult |
Arabidopsis thaliana |
| cyclopropane fatty acids |
has |
transgenic plants producing them |
|
| SWAM1-DR line |
was generated by |
overexpressing the full-length coding region fused to the 39-base pair dominant repressor EAR motif |
Brachypodium distachyon |
| binary vectors |
carry in cis |
LexAop sequences upstream of H2B-green fluorescent protein (GFP), H2B-yellow fluorescent protein (YFP), H2B-mKusabira Orange or H2B-mCherry |
Arabidopsis thaliana |
| CRISPR/Cas9 editing |
was used to introduce |
deletion mutations into all three TaDEP1 homoeologs |
Triticum aestivum |
| smart breeding |
uses |
complex gene modification and regulation |
|
| attempts to produce homozygous knockout lines for LPLA and (LIP2, LIP2p1, AT4G31050) |
failed in repeated trials |
homozygous knockout lines |
Arabidopsis thaliana |
| targeting vector with a loxP site at the promoterless 5′ end of the coding region of a second selectable marker |
may aid in obtaining |
precise SSI lines only |
Arabidopsis thaliana |
| crosses between pOp6 lines and other activator lines |
generates |
various functional combinations |
|
| maize orthologs of FON2 (ZmCLE7) and (CPL4, FCP1, AT5G58003) (ZmFCP1) |
were mutated |
in this study |
Zea mays |
| wild-type strain CC-124 |
was transformed with |
construct expressing amiRNA targeting CYG12 3′-UTR |
Chlamydomonas reinhardtii |
| plastid transformation |
has succeeded so far in only a few species |
transformation success |
|
| Line m8-1 |
is |
(MED8, AT2G03070) gene-edited algae strain |
Phaeodactylum tricornutum |
| Os07g0141400 knockout lines |
were generated using |
CRISPR/Cas9 system |
Oryza sativa |
| members of the CpSRP pathway |
can be exploited in |
strain optimization for high density cultivation of diatoms |
Phaeodactylum tricornutum |
| (S8H, AT3G12900) overexpression ( Ox) lines |
were generated using |
cauliflower mosaic virus (CaMV) 35S promoter |
Arabidopsis thaliana |
| site-directed mutagenesis |
was performed using |
QuikChange Site-Directed Mutagenesis Kit |
|
| changing cis-acting elements in gene promoter regions via genome editing |
can activate |
gene expression in the tissue of interest |
|
| multi-R-gene stacks |
can be generated through |
DNA engineering and transformation |
Triticum aestivum |