Notice: Database construction is still in progress. Certain features may be incomplete, slower than usual, or temporarily unavailable while we re-ingest the knowledge graph with citation data. Thank you for your patience.
← All pathways

gene expression analysis

30260 relationships annotated with this phrase. Showing first 500 of 30260.
Source entity Relationship Target entity Species
herbicide-resistant 'R' samples form separate clusters from susceptible 'S' counterparts on PC2 Alopecurus myosuroides
OsbHLH92 expression in internodes is detected by GUS staining Oryza sativa
4142 differentially expressed genes (DEGs) means that significant proportion of genes in Thalassiosira pseudonana (> 30%) changed expression as consequence of resting-cell formation Thalassiosira pseudonana
(ATAIG1, BHLH32, TMO5, AT3G25710) and (AT2G30680) expression is confirmed by RT-qPCR and ChIP-qPCR experiments on (H3.3, HTR8, AT5G10980) K27A seedlings Arabidopsis thaliana
Parametric gene set enrichment analysis (PGSEA) was used to understand the overall significant biological changes between WT and the hvtdf1-2 mutant Hordeum vulgare
metagenomics is advocated for examining potential roles of the rhizosphere microbiome in in situ gene expression
real-time quantitative polymerase chain reaction was used to analyze expression levels of PsSOC1 during chilling- and GA 3 -induced bud dormancy release
Group 4 genes is specific for interaction effects Arabidopsis thaliana
some (AMS, AT2G16910) expression was retained in the hvtdf1 mutant Hordeum vulgare
whole RNA-Seq of flower tissue from pools of diverging flower color individuals revealed strongly reduced gene expression of both annotated AhMYB2 isoforms in green flowers compared with red flowers Amaranthus hypochondriacus
GUSPlus reporter gene expression assays performed on multiple tissues and growth stages of gametophytes and sporophytes Pteris vittata; Ceratopteris thalictroides
RNA-seq analysis using laser microdissection was performed on roots grown in aerated nutrient solution without or with H₂S, or in stagnant solution Oryza sativa
relative transcript levels of their TR paralogs were examined in detail in F. tataricum and F. esculentum Festuca tataricum; Festuca esculentum
transcriptomic sequencing analysis was conducted on panicles of WT and OsOSC10 overexpression lines Oryza sativa
GO term enrichment in SlTRM5 cluster is shared with wgcna cluster containing SlTRM19/SlTRM26a Solanum lycopersicum
cRT-PCR experiments performed on edited Neopyropia yezoensis Neopyropia yezoensis
GeneYSDR001550 showed higher expression level in male tissues than in female tissues Spinacia oleracea L. subsp. turkestanica
GeneYSDR001580 showed higher expression level in male tissues than in female tissues Spinacia oleracea L. subsp. turkestanica
Endogenous NADP-ME genes were compared with expression of transgenic alleles Glycine max
RT-qPCR analysis was performed under normal conditions and recovery conditions (2 h) Triticum aestivum
(AGL61, DIA, AT2G24840) shows logFC = −4.98 Ipomoea purpurea
∆kmt1_oPf2_B transformant had highest number of DEG Leptosphaeria maculans
no obvious trends detected to suggest Hieracium spp. cell type contigs were biased for expression in any one Arabidopsis cell type Hieracium praealtum; Arabidopsis thaliana
(ATCHS, CHS, TT4, AT5G13930) and (ANS, LDOX, TDS4, TT18, AT4G22880) genes highly expressed at stages S4 and S5 Quercus dentata
Lam1 expression is low in young panicle Oryza sativa
QuantAS quantifies changing state of isoforms
RAD51-GFP line enables simultaneous detection of RAD51-GFP mRNA and RAD51-GFP protein levels in same cells Arabidopsis thaliana
Group 2 genes is specific for bud position effects Arabidopsis thaliana
RNA-seq analysis was performed on tissues from the outer part of the root Oryza sativa
1912 differentially expressed genes (DEGs) in (AtHMGB1, HMGB1, NFD1, AT3G51880) mutant plants compared to WT plants under HP conditions were identified by RNA-seq analysis Oryza sativa
genes meeting these criteria compared with the nucellus and its corresponding whole ovule sample Arabidopsis thaliana
temporal series of genome-wide transcriptomes is presented in this study Zea mays
individual (RLK, AT5G67280) genes show similarities and divergences in gene expression Arabidopsis thaliana
Semi-quantitative RT–PCR analysis uses gene-specific oligonucleotides F2-2CPB
RT-PCR analysis was used to detect (AOX1D, AT1G32350) expression Arabidopsis thaliana
most TFs barely expressed at green leaf stages S1–S3 Quercus dentata
RNA-seq analysis was performed on node in three conditions Oryza sativa
(DEP1, AT5G53850) promoter is expressed at low levels in leaves Oryza sativa
RNA-seq experiments performed to find out what makes guard cells special compared with other leaf cells in vascular plants
signal intensities are normalized and compared in fold change-transformed values relative to control sample
GO terms enriched in OVATE cluster is shared with SlTRM19/SlTRM26a cluster Solanum lycopersicum
262 genes showed statistically significant difference in expression between contrasting NILs Capsicum annuum
downregulation of genes enriched in oxidoreductase acting in the NAD(P)H pathway was further confirmed by gene heatmap analysis Hordeum vulgare
RNA-seq analysis was performed on AZ and tissues immediately above (U) and below (L) it at 21 and 31 d, and AZ at 38 d Setaria viridis
∆kmt1 mutant showed fewest DEG compared with WT strain Leptosphaeria maculans
(NFD6, AT2G20585) protein shows log-fold change of −3.97 across resistant individuals as compared to the susceptible individuals Ipomoea purpurea
Lam1 expression is low in root Oryza sativa
WGCNA clustering did not show much overlap among TRMs, OVATE, and SlOFP20 Solanum lycopersicum
transcript measurements were performed with wild-type (WT) and different almt mutant plants Arabidopsis thaliana
gene expression levels for AhCYP76AD2 and AhDODAα1 were similar between red and green bulk of biosynthesis BSA Amaranthus hypochondriacus
glasshouse experiments yielded transcriptome data six non-woody plant species
high-quality Quercus dentata genome combined with RNA sequencing Quercus dentata
slr1-d1 was analyzed for global transcriptomes
bar-coded libraries from four types of RNA were sequenced via Illumina-based technology Melianthus minor
Gene expression of transgenic malic enzyme was assessed over seed development Glycine max
signal intensity in Xenium™ analysis corresponds to transcript abundance
monolignol genes within the saccharification yield QTL differ by 5-fold or more between B73 and Mo17 in expression level Zea mays
RECT genes were assembled for specific analysis Mesembryanthemum crystallinum
1,940 Gene Ontology (GO) terms contained 135 that were linked to acclimation or responses to stimuli and stresses Arabidopsis thaliana
FaSAMDC mRNA expression levels significantly decreased in RNAi fruits Fragaria ananassa
more than 700 independent families showed 57.6% overexpression Oryza sativa
Northern blot analysis was used to detect AOX isoform expression Arabidopsis thaliana
MIR reverse primer used for RT-PCR
different primers and TaqMan probes were designed for QuantAS, relative quantification, and semi-quantitative RT-PCR
mRNA-seq analysis was performed on 30-d-old calli from (H3.3, HTR8, AT5G10980) and K27A lines Arabidopsis thaliana
Physcomitrium patens plants surviving G418 (Geneticin) treatment were analyzed by qPCR Physcomitrium patens
(RPL10, RPL10A, SAC52, uL16z, AT1G14320) promoter drives expression of GUS gene Arabidopsis thaliana
RNA extraction was used for transcriptomic analysis Populus spp.; Laccaria bicolor
Endogenous NAD-ME genes were compared with expression of transgenic alleles Glycine max
quantitative polymerase chain reaction analysis is used to measure gene expression levels Gossypium hirsutum
differentially regulated genes in response to red light:far-red light ratio grouped into four major groups Arabidopsis thaliana
Arabidopsis thaliana plants expressing (H3.3, HTR8, AT5G10980) K27A variant analysed with transcriptomics Arabidopsis thaliana
(DEP1, AT5G53850) promoter is mainly expressed in young panicles Oryza sativa
gene expression from bulked flower tissue was quantified using RNA-seq Amaranthus hypochondriacus
(RPL10B, uL16y, AT1G26910) promoter drives expression of GUS gene Arabidopsis thaliana
their expression levels were analyzed in tomato roots by qRT-PCR Solanum lycopersicum
33 genes annotated in MSY region were detected by qRT-PCR Spinacia oleracea L. subsp. turkestanica
expression levels of ethylene biosynthetic and perception genes ( (ACO1, AT4G35830) (ACS2, AT-ACC2, AT1G01480) (ACS6, ATACS6, AT4G11280) NR, ETR4) and PR genes ( (AtCAPE9, ATPR1, PR 1, PR1, AT2G14610) PR-1a1, PR2b) were examined in both WT and erf.c1 mutants Solanum lycopersicum
vector-based correlation is used to establish similarity between transcripts in indices and data of interest
seed family ( (CC2, AT5G42860) vs CC5) is stronger source of variance accounting for c. 58% of total variance on (APC1, PC1, AT5G17480) Alopecurus myosuroides
RNAseq was used to obtain broader insight in transcriptional differences between contrasting NILs Capsicum annuum
Expression of the constructs in transgenic lines was confirmed by western blot and quantitative RT-PCR assays Arabidopsis thaliana
control (nonherbicide) environment found 623 DETs when comparing resistant and susceptible individuals Ipomoea purpurea
Elongation factor 1-beta (Elf1b) served as reference gene to normalize expression values Glycine max
transcriptome profile analysis was performed as control Triticum aestivum
Affymetrix (ATH1, AT4G32980) Genome Arrays used to analyze transcriptome changes in response to red light:far-red light ratio Arabidopsis thaliana
GUS expression from pμ2:GUS detected in stamen Arabidopsis thaliana
GUS expression from pμ2:GUS detected in developing siliques Arabidopsis thaliana
SlTRM17/20a and SlTRM19 in developing fruit tissues despite highest expression in developing fruit tissues, these genes were correlated with two to five OFPs respectively but only during floral development Solanum lycopersicum
putative cost loci should be differentially expressed in the absence of herbicide Ipomoea purpurea
OsbHLH92 expression in lamina joints is detected by GUS staining Oryza sativa
results of PGSEA exhibited specific expression patterns for each process Hordeum vulgare
GUS expression from pμ2:GUS detected in pollen Arabidopsis thaliana
SlTRM3/4 in fruit development showed highest correlation with two OFPs (SlOFP7 and SlOFP10) Solanum lycopersicum
changing trend of isoforms in different tissues and treatments is consistent between methods
QuantAS is superior to semi-quantitative RT-PCR in terms of accuracy, compatibility, and specificity
transcriptomic analysis of Syntrichia ruralis sequenced average of 16 million reads per replicate (n = 3) per condition Syntrichia ruralis
lrx mutants show reduced amplification of sequences 3′ of insertion sites Arabidopsis thaliana
Affymetrix 57K rice genome chip was employed to assess pollen expression profile of suspected allergens Oryza sativa
chloroplast genes were co-regulated as suggested by hierarchical cluster analysis of expression patterns Arabidopsis thaliana
WGCNA reflected specific spatial-temporal expression by grouping OFPs and TRMs in clusters of co-expressed genes Solanum lycopersicum
GO terms enriched in OVATE cluster are shared with SlTRM5 cluster Solanum lycopersicum
AS isoforms that are easily detected by RT-PCR are provided as examples for comparison of QuantAS and RT-PCR
heatmap of enriched pathways showed some of them showed delayed expression rather than downregulation Hordeum vulgare
reduced expression of CaPtr1 and CaZAR1 in CaPtr1-CaZAR1-VIGS peppers was measured by quantitative RT-PCR Capsicum annuum
mRNA abundances of chloroplast- and nuclear-encoded subunits of the cyt-bf were compared between young and mature wild-type leaves Nicotiana tabacum
genes differentially expressed 5-fold or greater in QTL8 number 29 Zea mays
PP2AB′1 expression was confirmed by quantitative reverse transcriptase (qRT)-PCR Medicago truncatula
whole ovary tissues were used transcriptomic analysis Hieracium spp.
GO enrichment analysis and PAGE closely correspond observed GO term enrichments
non-competitive RT–PCR is used to detect gene transcripts
histone gene H3.2 used as control Arabidopsis thaliana
RNA sequencing was performed on ectomycorrhizas Populus spp.; Laccaria bicolor
pOp:WUS leaky expression is confirmed by expression levels of (PGA6, WUS, WUS1, AT2G17950) and (AtCLV3, CLV3, AT2G27250) Arabidopsis thaliana
transcriptomic data from active and dormant axillary buds subjected to co-expression analyses Arabidopsis thaliana
Group 1 genes is specific for R:FR effects Arabidopsis thaliana
real time PCR and parallel reaction monitoring (PRM) measurements revealed strong reduction of man1A mRNA beneath the detection limit Chlamydomonas reinhardtii
total RNA isolated and analyzed using RNA hybridization with different probes
red color in transcript analysis visualization marks up-regulation of transcript abundance Arabidopsis thaliana
transcript abundances of (PETB, ATCG00720) and (PETD, ATCG00730) were not reduced mature leaves Nicotiana tabacum
anther tissues were selected for Y2H screening based on similarities in expression profiles from qPCR and western analysis Oryza sativa
transgenic lines expressed higher levels compared to control plants Arabidopsis thaliana
ABI 7300 real-time PCR system used for two-step RT–PCR
RNA analysis was performed using gene-specific probes
H3.2 replacement histone variant gene (HTR6, AT1G13370) increased expression confirmed by RT-PCR in independent leaf samples of msi1-cs plants Arabidopsis thaliana
PHT4;6 gene amplified by PCR
atTIC55-II specific primers used for amplification of atTIC55-II
pKIN17::GUS transgenic lines show (AtKIN17, KIN17, AT1G55460) spatial and temporal expression pattern Arabidopsis thaliana
temperature sensitization hypothesis required additional validation by transcriptome profiling Arabidopsis thaliana
developing internodes 4 and 5 of greenhouse-grown (B73, CHL6, CNX, CNX1, SIR4, AT5G20990) and Mo17 parents were used for expression analysis (RNA sequencing) Zea mays
16 out of 20 genes confirmed by RT–PCR Arabidopsis thaliana
reverse transcription PCR analyses used to detect paternal transcripts Oryza sativa
RT-PCR using primers flanking insertion site amplifies product of predicted size from SMT15 complementary DNA (cDNA) from wild-type RNA Chlamydomonas reinhardtii
(CYP707A3, AT5G45340) transcripts were detected in RNA-seq analyses Arabidopsis thaliana
seed transcriptome showed little correlation with seed proteome Arabidopsis thaliana
RNA-seq is more robust and sensitive in identifying transcript units even at low levels of expression
Northern blot analysis indicated transgenic lines expressed higher transcript levels Arabidopsis thaliana
primer P-6 (5′-ACTGCCATCGCCAAGAGC-3') used in RT–PCR analysis
Tubulin-F and R primers used as control for RT-PCR analysis
HvCSLC gene expression measured by quantitative PCR (qPCR) Hordeum vulgare
MAIF1 promoter–GUS transgenic plants used to determine MAIF1 expression patterns
each determination includes three biological replicates Arabidopsis thaliana
OsMED14_1 promoter fused upstream of β-glucuronidase (GUS; uidA) gene Oryza sativa
NanoString Technology is suitable for measurements with multiple time points Arabidopsis thaliana
set of genes for interrogation included mRNA for all proteins that had shown a change in response to Fe deficiency Arabidopsis thaliana
UGT, cytokinin oxidase, phenazine biosynthesis, aspartic protease, purple acid phosphatase, and type A response regulator-like genes were verified by RNA isolation from apomict Hieracium R35 ovaries and resequencing Hieracium praealtum
C-Lectin and SD-3 subfamilies are excluded from expression divergence analysis
microarray analysis identified candidate genes with consistent changes Arabidopsis thaliana
genes not meeting this criterion were called not detected Arabidopsis thaliana
leaf tissue RNA extracted from RNA
qPCR amplification performed using method described by Burton et al. (2008) Hordeum vulgare
RNA-seq comparison of transcriptomes identified genes and pathways with significantly different basal expression strengths Schrenkiella parvula; Arabidopsis thaliana
PsaD mRNA accumulation was determined by northern-blot analyses Nicotiana tabacum
Qualitative RT–PCR results partially agree with published transcript expression data Arabidopsis thaliana
fold change of given stages compared to 3 DAF Log2 transformed in hierarchical analysis Brassica napus
WRKY-like sequence is highly expressed in Mo17 Zea mays
TcGLIP expression is verified by quantitative reverse transcription PCR (qRT-PCR) Tanacetum cinerariifolium
set of genes for interrogation was complemented with genes encoding major Fe binding protein subunits Arabidopsis thaliana
GO:0009631, cold acclimation was term with highest mean log2-FC and identical with persistently correlated term Arabidopsis thaliana
observed GO term enrichments are independent of arbitrary p-value or fold change thresholds
genes meeting this criterion were considered expressed Arabidopsis thaliana
RT–PCR indicated that relative transcript expression in Arabidopsis was moderate for (GAUT3, AT4G38270) (GAUT5, LGT5, AT2G30575) (GAUT6, AT1G06780) (GAUT10, LGT4, AT2G20810) (GAUT14, AT5G15470) and (GAUT15, AT3G58790) Arabidopsis thaliana
seedlings total RNA was extracted from total RNA
percentages of increase in gene expression were normalized to average values for each individual seedlings adapted in darkness
Fragaria vesca L. (spp. vesca forma alba (Her.) Staudt, white fruits) is used for real-time quantitative PCR Fragaria vesca
sulfate transporter genes analyzed by semi-quantitative RT–PCR
Gene Expression Analysis for iCycle iQ® Real Time PCR Detection System software uses method derived from algorithms outlined by Vandesompele et al. (2002) Vitis vinifera
known (MIR159, MIR159A, AT1G73687) and (MIR319, MIR319B, AT5G41663) targets expression was determined using qRT-PCR Arabidopsis thaliana
PoGT43A amplified by PCR primers PCR primers 5'-gttcgatcctttgggatcctgaga-3' and 5'-tcatagttttctcctgctagcatc-3' Populus trichocarpa
developing xylem tissues used for total RNA isolation
high-quality RNA-seq reads were mapped onto FER_r1.1.pseudomolecule reference Ficus erecta
24 CYP genes exhibited significantly higher expression levels in leaf and stem than in root Strobilanthes cusia
468 genes were identified in both generations Festuca pratensis; Lolium multiflorum
quantitative reverse transcriptase (qRT)-PCR was performed to address biological function of (PSS1, AT3G59640) Arabidopsis thaliana
DEGs between wild type and fc mutants at beginning of deetiolation were analyzed using GSLA and other tools Arabidopsis thaliana
Genevestigator Version 3 was used to perform Meta-Profile Analysis for transcript analysis Arabidopsis thaliana
mature leaves after 7 d of RNA induction more RNA had to be loaded to obtain detectable signals of nuclear-encoded genes Nicotiana tabacum
immunoblot analyses confirmed target gene silencing Kalanchoe fedtschenkoi
35S::HWS plants displayed miRNA target enrichment Arabidopsis thaliana
TcADH1 expression is verified by quantitative reverse transcription PCR (qRT-PCR) Tanacetum cinerariifolium
strong reduction of man1A mRNA confirmed on protein level Chlamydomonas reinhardtii
transgenic plants harboring (EMF1, AT5G11530) promoter::glucuronidase (GUS) reporter gene displayed differential GUS activity in vegetative and flower tissues Arabidopsis thaliana
green color in transcript analysis visualization marks down-regulation of transcript abundance Arabidopsis thaliana
Among the plastid-encoded genes, only the mRNA abundances of (PETG, ATCG00600) and petN were significantly decreased in mature leaves Nicotiana tabacum
(AtKIN17, KIN17, AT1G55460) mRNA levels are relatively more moderate in seedlings, siliques, and roots Arabidopsis thaliana
RNA-seq analysis was performed on apices of Chasselas Dore and Chasselas Ciotat growing shoot tips Vitis spp.
qRT-PCR analysis results were generally consistent with read frequencies from transcriptomic profiling experiments Tanacetum cinerariifolium
enrichment analysis assessed enrichment of up- or down-regulation among gene sets of 1,940 Gene Ontology (GO) terms Arabidopsis thaliana
functional enrichment analysis applied to all included 1,940 GO terms Arabidopsis thaliana
expression patterns within (RLK, AT5G67280) subfamilies were analyzed for conservation or divergence using Pearson correlation coefficient metric
tubulin was used as loading control Arabidopsis thaliana
RT-PCR primers could amplify four different N. tabacum myosin XI genes and one myosin VIII gene Nicotiana tabacum
three LRR XIII subfamily members with known functional overlaps have expression profiles that are similar
RNAs subjected to RT–PCR Oryza sativa
homozygote T3 generation Shengkang No. 1 lines subjected to Semi-Quantitative RT–PCR Analysis
22 of these proteins had mRNA levels significantly changed in at least one of the 16 selected microarray datasets
(CYP707A1, AT4G19230) transcripts were detected in RNA-seq analyses Arabidopsis thaliana
(AIRP3, AtAIRP3, LOG2, AT3G09770) value of at least 1 is used as cutoff to select differentially expressed transcripts Arabidopsis thaliana
TcADH2 expression is verified by quantitative reverse transcription PCR (qRT-PCR) Tanacetum cinerariifolium
embryo axes used for real-time quantitative PCR analysis Medicago truncatula
average-linkage hierarchical clustering based on average-linkage gene expression distances
barley cDNA collection used as template for HvCSLC gene expression measurement Hordeum vulgare
qPCR analysis compared FT and (AGL9, SEP3, AT1G24260) transcript levels over time Arabidopsis thaliana
15 GAUT genes were analyzed using RT–PCR
NbCOMT examined using gene-specific primers
strict consensus de novo approach is supported by finding of 19 genes significantly regulated by ABA through qPCR Physcomitrella patens
RNA extracted from roots and shoots of 6-day-old seedlings Arabidopsis thaliana
pair of (ATFH8, FH8, FORMIN 8, AT1G70140) specific primers (forward: CAGTTTCGATGGCGATTTAATGGAA; reverse: TGAGCACAATCGCTGTGTTTT GAGA) was used to conduct standard RT–PCR Arabidopsis thaliana
RNA sequencing (RNA-seq) identified differentially expressed genes (DEGs) Oryza sativa
(CYP707A2, AT2G29090) transcripts were detected in RNA-seq analyses Arabidopsis thaliana
RT–PCR indicated that relative transcript expression in Arabidopsis was low for (GAUT2, LGT2, AT2G46480) (GAUT7, LGT7, AT2G38650) (GAUT11, AT1G18580) and (GAUT13, AT3G01040) Arabidopsis thaliana
GUS expression from pμ2:GUS detected in dark-grown hypocotyls Arabidopsis thaliana
GUS expression from pμ2:GUS detected in rosette leaves Arabidopsis thaliana
Quantitative real-time reverse transcription PCR (qRT-PCR) is used to study gene expressions Brassica napus
in situ hybridization was used to analyze TaeSultr1;1 spatial expression Triticum aestivum
NbCCR examined using gene-specific primers
upregulated DEGs in present study overlap with upregulated DEGs in Koussevitzky et al. (2007) Arabidopsis thaliana
Zhao et al. (2019b) study performed RNA sequencing in gun1-9 mutant Arabidopsis thaliana
total RNAs were extracted from different plant organs and tissues Nelumbo nucifera
abundance of the nuclear-encoded (PETC, PGR1, AT4G03280) and (PetM, AT2G26500) mRNAs was clearly decreased mature leaves Nicotiana tabacum
(ATGRP7, CCR2, GR-RBP7, GRP7, RBGA3, SRBP1, AT2G21660) and (AtSOD1, CSD1, SOD1, AT1G08830) are absent in comparison of MIM156 to Col-0 Arabidopsis thaliana
gene expression levels were compared using two complementary approaches
Tubulin loading control was amplified using Tubulin-specific primers
Fra a 1e 5′-UTR amplified by qPCR with specific primers Fragaria × ananassa
TaeSultrt2;1 shows no expression in wheat grains
T-DNA insertion lines were tested for transcript abundance
NbCesA6 examined using gene-specific primers
PipCoA ligase transcripts were virtually non-existent in roots Piper nigrum
cDNA substrate for qPCR analysis Fragaria × ananassa
wheat (Triticum aestivum) root sections processed for in situ hybridization Triticum aestivum
ΔCt = Ct Target – Ct Ubiquitin was used to obtain normalized expression of VvMYC1 Vitis vinifera
thermal cycle program includes 95°C for 15 min initial denaturation Arabidopsis thaliana
RNA-seq reads over 88% aligned to Strobilanthes cusia genome uniquely Strobilanthes cusia
PCA and hierarchical cluster analyses showed distinct separation at transcriptome level Oryza sativa
putative families were used for co-expression analyses Arabidopsis thaliana
ACTIN primers is used as control to determine uniformity of cDNA concentration
variable amounts of total RNA from Mn1 and mn1 endosperm shows greater steady state level of (TAR1, AT1G23320) RNA in mn1 kernels Zea mays
actin is amplified in RT-PCR process with 25 cycles
transketolase-2 gene transcript levels were quantified by reverse transcription-quantitative PCR (RT-qPCR) Salvia miltiorrhiza
Richter et al. (2020) study reported NF-responsive transcriptome changes in gun1-1 mutant Arabidopsis thaliana
307 genes were downregulated after cold stress treatment compared with control conditions Festuca pratensis; Lolium multiflorum
nodule centered expression of GmSPX5 was verified through GUS staining in transgenic soybean plants harboring Pro GmSPX5:GUS Glycine max
(CCZ1a, AT1G16020) gene transcript levels were confirmed by quantitative real-time PCR (RT-qPCR) Arabidopsis thaliana
Klie et al. analyzed transcriptome profiles from Arabidopsis Arabidopsis thaliana
nuclear signal can be used to extract gene expression
pair of (ATFH8, FH8, FORMIN 8, AT1G70140) specific primers (forward: CAGTTTCGATGGCGATTTAATGGAA; reverse: TGAGCACAATCGCTGTGTTTT GAGA) was used to conduct fluorescence quantitative PCR Arabidopsis thaliana
RNA-seq analysis did not find differences in distribution of sequence reads in 5′ → 3′ direction in gene body between cur1 and WT Oryza sativa
leaf tissue collected and quick frozen for RNA isolation
Phenylalanine Ammonia-Lyase (ZmPALb) analyzed using gene-specific primers Zea mays
Nb4CL examined using gene-specific primers
Fragaria chiloensis (spp. chiloensis forma patagonica, red fruits) is used for real-time quantitative PCR Fragaria chiloensis
normalized expression of VvMYC1 gene was calculated using Gene Expression Analysis for iCycle iQ® Real Time PCR Detection System software Vitis vinifera
ZmCesA5 analyzed using gene-specific primers Zea mays
ZmCesA9 analyzed using gene-specific primers Zea mays
(ANAC059, ATNAC3, NAC3, ORS1, AT3G29035) promoter fused to β-glucuronidase (GUS) reporter gene Arabidopsis thaliana
PtdCesA8A-specific forward and reverse primers used for semi-quantitative RT-PCR experiments
pairwise transcriptome comparisons identified differentially expressed genes (DEGs) with fold change >2 and FDR <0.05 Prunus persica
expression of anthocyanin biosynthetic genes and transcription factors was validated by qPCR analysis Prunus persica
quantitative PCR uses 200 nM oligonucleotides Arabidopsis thaliana
100 mg of 7-day-old seedlings was used to extract RNA Arabidopsis thaliana
hierarchical clustering analysis of 907 DEGs showed significant upregulated and downregulated genes in fruit stored at 16°C Prunus persica
240 CYPs expressed with FPKM >0.5 in at least one sample Strobilanthes cusia
NF-treated (ABAR, CCH, CCH1, CHLH, GUN5, AT5G13630) mutant shows more downregulated DEGs and larger changes than other mutants Arabidopsis thaliana
NbCesA8 examined using gene-specific primers
whole-gene translational fusions with reporter genes revealed broad extent of (ATSUC1, SUC1, AT1G71880) and (ATSUC9, SUC9, AT5G06170) expression Arabidopsis thaliana
NF-treated (GUN1, AT2G31400) and (ABAR, CCH, CCH1, CHLH, GUN5, AT5G13630) mutants show overlap of DEGs with Richter et al. (2020) study Arabidopsis thaliana
Fudingdabai haplotype B of W03g008694 was significantly higher than Fudingdabai haplotype A of W03g008694 Camellia sinensis
line OX.ALMT1-1 had 23-fold higher transcript levels of (ALMT1, ATALMT1, AT1G08430) than WT (P-value < 0.01) Arabidopsis thaliana
shoot genes were grouped into eight clusters Noccaea caerulescens
biosynthetic pathways were characterized via targeted transcriptomics by bait-gene co-expression analysis
Northern analysis performed on leaf tissue from ethylene-treated plants
(YUC, YUC1, AT4G32540) RNA is detected at all levels of loading with much longer X-ray film exposure Zea mays
ACL1 is amplified in RT-PCR process with 35 cycles
semi-quantitative RT-PCR was performed on total RNA extracted from stems
M171 clone had 582 differentially expressed genes (DEGs) Vitis vinifera
DEGs in (GUN1, AT2G31400) mutant show good overlap in both gun mutants Arabidopsis thaliana
(CDC73, PHP, AT3G22590) and elF2B transcripts were checked for being expressed fairly equal among different organs Piper nigrum
DPS gene transcript levels were quantified by reverse transcription-quantitative PCR (RT-qPCR) Salvia miltiorrhiza
ten (LEA, AT2G21490) genes from different groups were selected to determine expression pattern by real-time PCR (RT-PCR) analysis Acer truncatum
Festuca homoeologs is predominantly being modified in genes exhibiting highest expression level changes Festuca pratensis; Lolium multiflorum
single-cell studies have revealed remarkable variation in population-level gene expression in Pseudomonas syringae Pseudomonas syringae
EST data may be especially non-uniform Oryza sativa
spike in (ACS, AT5G36880) gene expression at 2 dpi often occurs in both inoculated and non-inoculated roots Glycine max
transcript size of 1500-2000 nucleotides is larger than expected 1033 nucleotides Nicotiana tabacum
(ATWRKY34, MSP3, WRK34, WRKY34, AT4G26440) expression and subcellular localization in response to cold stress was investigated using promoter–GUS analysis Arabidopsis thaliana
in situ hybridization results reflect results observed by qRT-PCR analysis Agave tequilana
Fragaria vesca L. (Reina de los Valles, red fruits) is used for real-time quantitative PCR Fragaria vesca
atakt1-2 line were analyzed for (ATHAK5, HAK5, AT4G13420) expression Arabidopsis thaliana
up-regulated genes defined as genes with greater than or at least two-fold linear intensity ratio
poplar stems total RNA isolated from total RNA Populus trichocarpa
(TAT, TAT3, AT2G24850) gene transcript levels were quantified by reverse transcription-quantitative PCR (RT-qPCR) Salvia miltiorrhiza
SST gene expression in Pna-10 is statistically significantly higher than SST gene expression in Pna-17
primers MYCF2s and MYCR3s amplify 159-bp PCR-fragment from VvMYC1 Vitis vinifera
PoGT8D-2 amplified by PCR primers PCR primers 5'-tcgagcaaagccttggctagatatagc-3' and 5'-tcatgtcctaatatgacagcccgtaat-3' Populus trichocarpa
RNA-seq analysis obtained 135 million RNA-seq reads from four samples Ficus erecta
glucosidase II β-subunit gene has highly similar expression pattern to (ERD2B, AT3G25040) Arabidopsis thaliana
ZmCesA12 analyzed using gene-specific primers Zea mays
four different statistical methods obtained high confidence and statistically significant dataset for differentially expressed genes Triticum aestivum
grain and stem/rachis sections processed for in situ hybridization Triticum aestivum
VvMYC1 transcript levels were measured using iCycler iQ® (Bio-Rad) Vitis vinifera
PtdCesA4A-specific forward and reverse primers used for semi-quantitative RT-PCR experiments
Fra a 2 gene expression investigated using qPCR with specific primers Fragaria × ananassa
VvMYC1 expression was normalized to transcript level of VvUbiquitin1 Vitis vinifera
each determination includes three technical repeats Arabidopsis thaliana
subset of 394 genes differentially expressed in both HRS and HS treatments and during both days 1 and 11 of heat treatment was analyzed further for functional enrichment Chenopodium quinoa
reverse transcriptase (RT)–polymerase chain reaction (PCR) analyzes transcript population Setaria viridis
FPN3p-GUS construct is transformed into wild-type Arabidopsis Arabidopsis thaliana
single-cell approaches can increase spatial and temporal resolution of developmental and adaptive processes
TRAP-seq enables mapping of translating RNAs in specific cell and organ types
Fra a 3 3′-UTR amplified by qPCR with specific primers Fragaria × ananassa
RNA extraction and RNA gel-blot analyses is used for gene expression detection
(AtMYB97, MYB97, AT4G26930) continually failed to be detected in wild-type plants Arabidopsis thaliana
total RNA isolated using Macherey and Nagel extraction method Arabidopsis thaliana
Ghd8 amplified by primer pair C8dsF and C8dsR
genes differentially expressed exclusively in the treatments with yield loss (HRS and HS) were analyzed further to associate gene expression with yield loss Chenopodium quinoa
10,981 DEGs were identified between 16°C and 0°C, 5°C, 8°C, 12°C temperature treatments Prunus persica
27,479 genes detected with expression levels of FPKM ≥0.5 in at least one sample Strobilanthes cusia
1314 upregulated and 1965 downregulated genes shared by leaf (L1 and L4) and stem (S1 and S2) Strobilanthes cusia
parental expression levels accounted for 4,443 and 4,239 genes in Festuca × Lolium and Lolium × Festuca hybrids Festuca pratensis; Lolium multiflorum
overlap of genes in ELD categories between F1 and F2 generations increased from 60.3% in young hybrids to 67.5% in hybrids after 4 years of cultivation to 83.1% in hybrids after cold stress Festuca pratensis; Lolium multiflorum
K-mean clustering of 4155 differentially expressed transcripts partitioned genes into six clusters associated with cell types Oryza sativa
α-tubulin reverse primer used for RT-PCR
GUS assays were performed for transgenic Arabidopsis plants Arabidopsis thaliana
PipCoA ligase gene expression was lower in light green and very young fruits (1 month post anthesis) Piper nigrum
nine hybrid plants together with parents were used for analysis of gene expression Festuca pratensis; Lolium multiflorum
different lines grouped secondly by genotype Solanum lycopersicum
electronic fluorescent pictograph (eFP) browser has been used to visualize Arabidopsis gene expression data Arabidopsis thaliana
whole-genome arrays make it possible to pursue detailed questions about gene expression Medicago truncatula
UGT, purple acid phosphatase, and type A response regulator-like genes showed enrichment in AI laser-captured samples Hieracium praealtum
RT-qPCR-based expression profiling was performed on senescence-associated genes, chlorophyll degradation genes, and ABA biosynthesis and signaling genes Solanum lycopersicum
RT-PCR analysis was performed on total RNA from wild-type and pht4;6-1 seedlings Arabidopsis thaliana
reverse transcription–PCR analysis uses 2 μg of total RNA
quality-controlled microarray data analyzed using GeneSpring GX software
cluster CV contained 972 genes preferentially expressed in veinal cells Oryza sativa
line OX.ALMT1-2 had 105-fold higher transcript levels of (ALMT1, ATALMT1, AT1G08430) than WT (P-value < 0.05) Arabidopsis thaliana
root genes were grouped into seven clusters Noccaea caerulescens
4-Coumarate CoA Ligase (Zm4CLa) analyzed using gene-specific primers Zea mays
Hydroxycinnamoyl-CoA shikimate/quinate hydroxycinnamoyl Transferase (ZmHCT) analyzed using gene-specific primers Zea mays
novel promoter:reporter gene fusion can determine spatial and temporal aspects of gene expression
Nr mutant has higher number of differentially expressed genes (DEGs) compared to etr3-ko mutant Solanum lycopersicum
nodule centered expression of GmSPX5 was verified through quantitative reverse transcription-PCR (qRT-PCR) analysis Glycine max
haplotype-resolved accessions provide helpful resource to investigate ASE genes Camellia sinensis
Cucumis metuliferus CM27 genes were confirmed by RNA-sequencing (RNA-seq) Cucumis metuliferus
cluster CBS contained 285 genes preferentially expressed in bundle sheath cells Oryza sativa
OX.STOP1-1 line had (ALMT1, ATALMT1, AT1G08430) transcript levels 10-fold higher than in WT (P-value < 0.01) Arabidopsis thaliana
single-cell RNA-sequencing and spatial transcriptomics enable analysis of developmental and adaptive processes at single-cell resolution
(ACS, AT5G36880) genes with the highest relative expression in the whole root RNA samples were mostly for genes that did not increase in SCN-colonized roots Glycine max
starch-branching enzyme class II (sbe2-1) has average Cy5/Cy3 ratio of 5.5 Phyllostachys praecox
starch-branching enzyme I (Rbe1) has average Cy5/Cy3 ratio of 5.5 Phyllostachys praecox
similarity of expression patterns between microarray and qRT-PCR suggests expression differences unlikely due to polymorphisms Solanum tuberosum
quantitative real-time PCR data were collected and analyzed using Rotor Gene 6.0 software
SST gene expression was measured by real-time RT-PCR
transgenic plants used for expression analysis of the GUS reporter gene Arabidopsis thaliana
RT-PCR analysis measures expression of ACL2 (ACETYL-COA LIGASE 2)
quantitative PCR uses fivefold diluted cDNA Arabidopsis thaliana
downregulated DEGs in present study overlap with downregulated DEGs in Koussevitzky et al. (2007) Arabidopsis thaliana
total expression level of homoeologous gene pairs in hybrids compared with expression level of their two parents Festuca pratensis; Lolium multiflorum
Lolium expression dominance remained almost the same after 4 years of cultivation Festuca pratensis; Lolium multiflorum
both homoeologs were upregulated in 11 (7.3%), 12 (6.6%), and 21 (11.4%) genes in category II Festuca pratensis; Lolium multiflorum
expression biases between two subgenome homoeologs reduces feasibility of coexpression analysis Triticum turgidum
Both constructs, along with pUbi-GUS were co-transformed by biolistic bombardment into maize endosperms Zea mays
BAR expression databases contain detailed expression analyses Arabidopsis thaliana; Populus trichocarpa; Triticum aestivum; Oryza sativa
transcriptional activity of TNP2-like transposase genes is differentiated in B. rapa and B. oleracea Brassica rapa; Brassica oleracea
highly expressed Fudingdabai alleles of these three genes showed higher expression levels than other alleles in some Fudingdabai relatives Camellia sinensis
OX.STOP1-1 line had MATE transcript levels 4-fold higher than in WT (P-value < 0.05) Arabidopsis thaliana
overlap of genes in categories between F1 and F2 increased from 60.3% to 67.5% Festuca pratensis; Lolium multiflorum
seven of the 10 WGD pairs of Dof genes in rice had sufficient data to assess in RiceXPro database Oryza sativa
702 genes responding significantly differently to cadmium exposure between accessions were identified when considering direction and magnitude of gene expression changes Noccaea caerulescens
(HCC1, AT3G08950) (HOMOLOGUE OF COPPER CHAPERONE SCO) expression in juvenile leaves is consistent with Genevestigator expression database Arabidopsis thaliana
AtProT transcript levels were determined in tissues where high expression of the respective gene had been shown Arabidopsis thaliana
(DFR, M318, TT3, AT5G42800) expression level was higher in overexpression seedlings than in wild-type Arabidopsis thaliana
pattern of gene expression of LsPIP2 gene was different in shoots and roots
(ASUS1, atsus1, SUS1, SUSY1, AT5G20830) transcript is lowest in cauline leaves and stem Arabidopsis thaliana
clones from suppression subtractive hybridization were printed on microarray Citrus sinensis
981 and 1,173 genes displayed transgressive expression Festuca pratensis; Lolium multiflorum
transgressive expression with downregulation being more frequent than upregulation Festuca pratensis; Lolium multiflorum
Lolium homoeolog was upregulated in 3 (2.0%), 6 (3.3%), and 5 (2.7%) genes in category II Festuca pratensis; Lolium multiflorum
expression biases among three sub-genome homoeologs makes coexpression analysis Triticum aestivum
effector–reporter construct and internal construct were co-transformed into maize endosperm Zea mays
OX.STOP1-2 line presented (AtSTOP1, STOP1, AT1G34370) transcript levels 4 times higher than WT (P-value < 0.01) Arabidopsis thaliana
transgenic T2 seedlings source of total RNA from whole 7-day-old seedlings
VvMYC1 transcript levels measured by qPCR Vitis vinifera
Northern blot analysis confirms q-PCR data Zea mays
ZmCesA8 analyzed using gene-specific primers Zea mays
Caffeic acid O-MethylTransferase (ZmCOMT) analyzed using gene-specific primers Zea mays
RNA was isolated from stage 12 flowers Arabidopsis thaliana
number of DEGs identified in 0°C, 5°C, 8°C, and 12°C relative to 16°C gradually decreased from 0°C to 12°C Prunus persica
CK2B1-promoter–β-glucuronidase (GUS) reporter revealed CK2B1 expression in all tissues of seedlings Arabidopsis thaliana
transcriptome analysis profiled spatio-temporal expressions of genes across different tissues Strobilanthes cusia
dedicated qPCR array applied to fruits at three different stages of development Solanum lycopersicum
(MON1, AT2G28390) gene transcript levels were confirmed by quantitative real-time PCR (RT-qPCR) Arabidopsis thaliana
W03g008694 haplotype A harbored by 12 accessions Camellia sinensis
functional enrichment analysis identified three categories over-represented in mesophyll cells Oryza sativa
nuclear analyses are particularly useful in quantification of single cell gene expression
environmentally regulated gene networks are increasingly investigated with advanced 'omics methods
k-mer approach is a suitable strategy for hybrid gene expression analysis Festuca pratensis; Lolium multiflorum
279 genes in F1 Festuca × Lolium hybrids displayed higher expression of Lolium homoeolog Festuca pratensis; Lolium multiflorum
Festuca homoeolog was upregulated in 136 (91.0%), 160 (87.9%), and 155 (83.8%) genes in category II Festuca pratensis; Lolium multiflorum
14 genes encoding enzymes and regulators displayed large difference in expression level among time points (1 to 6000 RPKM) Craterostigma plantagineum
T-DNA insertion mutant lines were tested with RT-PCR to assess presence or absence of transcript Arabidopsis thaliana
expression pattern of most of these genes were confirmed by qPCR Prunus persica
13 down-regulated genes down-regulated in greenhouse and vineyard S + R + plants Vitis vinifera
transgenic line OX.STOP1-2 displayed ALTM1 and MATE transcript levels similar to WT Arabidopsis thaliana
genomics approaches explore transcription levels Zea mays
k-mer approach is not biased by differential mapping efficacy to a reference sequence of either parent Festuca pratensis; Lolium multiflorum
RNA sequencing studies used to differentiate between maternal and paternal mRNAs
RNA-Seq expression is genomic assay
parallel sequential FISH (par-seqFISH) spatially maps gene expression profile of individual bacteria
RNA sequencing (RNA-seq) identified 95 differentially expressed genes (DEGs) including 60 upregulated and 35 downregulated DEGs Gossypium hirsutum
678 and 886 genes displaying Festuca expression dominance and Lolium expression dominance were identified in both reciprocal hybrids, in F1 and F2 hybrids early after establishment and in F1 and F2 hybrids after 4 years of cultivation Festuca pratensis; Lolium multiflorum
448 genes identified showing significantly different expression levels between Fudingdabai B and other haplotypes Camellia sinensis
cluster CBS&V contained 1015 genes preferentially expressed in bundle sheath and veinal cells Oryza sativa
genes can be examined for expression pattern across hundreds of RNA-seq samples Triticum aestivum
530 genes in F1 Lolium × Festuca hybrids displayed higher expression of Festuca homoeolog Festuca pratensis; Lolium multiflorum
expression divergence of retained homoeolog pairs examined in Oryza alta (CCDD) Oryza alta
expression of GUS reporter gene driven by the MYB46–SNBE1 sequence examined in transgenic plants Arabidopsis thaliana
ZmCesA2 analyzed using gene-specific primers Zea mays
RT-PCR analysis results were consistent with RNA-seq analysis at six seed development stages Acer truncatum
three CYP members (EVM0001614, EVM0008084, EVM0017260) highly expressed in leaf and stem Strobilanthes cusia
four expanded UGT members (EVM0023821, EVM0024034, EVM0013737 and EVM0005112) from other four subfamilies (A, E, G and L, respectively) significantly expressed in leaf and stem relative to root Strobilanthes cusia
expression profiles recovered from EST library mining may well not contain low abundance transcripts
P deficiency treatment had no consistent effect on HvALMT1 expression Hordeum vulgare
genes with preferential expression from Festuca homoeolog were slightly higher in number than genes with preferential expression from Lolium homoeolog Festuca pratensis; Lolium multiflorum
correlation analysis of transcript and protein levels was performed transcript and protein levels Craterostigma plantagineum
633 and 613 genes with preferential expression from Festuca homoeolog were only slightly more than 576 and 515 genes with preferential expression from Lolium homoeolog Festuca pratensis; Lolium multiflorum
all 5,790 genes were assigned to one of seven categories: cis-only, trans-only, cis + trans, cis × trans, compensatory, conserved and ambiguous Festuca pratensis; Lolium multiflorum
microarray analysis was performed in roots of plants grown under NO3− −Suc and NH4+ −Suc conditions Arabidopsis thaliana
TNP2-like transposase genes were examined for expression levels in different tissues Brassica rapa; Brassica oleracea
Fudingdabai haplotype A of MSTRG.4268.1 displayed significantly higher expression level than Fudingdabai haplotype B Camellia sinensis
(GEX3, AT5G16020) primers for Arabidopsis used in RT-PCR Arabidopsis thaliana
α-expansins were found in microarray study
high sequence similarity between three pTaExpA6 genes means that signal in images is likely to be sum of transcript levels of all three sequences
RT-PCR analysis of endogenous (BP, BP1, KNAT1, AT4G08150) (KNAT6, KNAT6L, KNAT6S, AT1G23380) and (AS1, ATMYB91, ATPHAN, LL2, MYB91, AT2G37630) expression was carried out on leaves of Agave KNOX- and Arabidopsis KNOX-overexpressing lines Arabidopsis thaliana
MdAF1 expression in mealy and non-mealy hybrids and parents was low for in planta fruits in planta fruits
(HCC1, AT3G08950) (HOMOLOGUE OF COPPER CHAPERONE SCO) expression in leaf primordia was not confirmed by Genevestigator expression database Arabidopsis thaliana
(CIPK3, SnRK3.17, AT2G26980) gene produces PCR product of 1.326 kb
(AT2353, ATGA20OX2, GA20OX2, AT5G51810) promoter drives GUS reporter gene expression Arabidopsis thaliana
RT-PCR conducted as described by Wen et al. (2003)
rice U-box protein genes have corresponding ESTs or full-length cDNAs Oryza sativa
PpSPY was highly expressed in rhizome shoots Phyllostachys praecox
gene expression analysis by microarrays offers broad insight into gene expression
promoter-GUS-reporter gene transformation identified expression patterns of OsNRT2s and OsNAR2.1 Oryza sativa
985 and 907 homoeolog pairs with significant differential expression level between parents displayed non-biased expression in Festuca × Lolium and Lolium × Festuca hybrids Festuca pratensis; Lolium multiflorum
885–939 genes in reciprocal hybrids were classified as unassigned Festuca pratensis; Lolium multiflorum
next-generation sequencing approaches is used for expression profiling
(ATMGT5, MGT5, MRS2-6, AT4G28580) mRNA expression pattern analyzed in anther Arabidopsis thaliana
(AGR, AGR1, ATPIN2, EIR1, MM31, PIN2, WAV6, AT5G57090) gene was amplified using (AGR, AGR1, ATPIN2, EIR1, MM31, PIN2, WAV6, AT5G57090) primers Arabidopsis thaliana
PtaRHE1 overexpression was first checked by RT-PCR Nicotiana tabacum
318 up-regulated genes were identified in rhizome buds Phyllostachys praecox
Nicotiana benthamiana plants grown in sulphur-sufficient conditions were used for trans-activation studies Nicotiana benthamiana
18 subtracted cDNA clones were more abundant in pale yellow plants with fold changes greater than two
in situ hybridization provides information on localization of expansin transcripts in maternal or endosperm tissues
four genes from refined list subjected to qRT-PCR analysis Solanum tuberosum
promoter–GUS reporter transgenic plants were used to identify OsNAR2.1 and OsNRT2 expression profiles Oryza sativa L.
MdAF3 gene in relative quantification analysis for fruit samples from individual hybrids exhibited differential expression patterns between mealy and non-mealy individuals at H1, S1, and S2 collection dates
hybrids classified as mealy showed predominantly higher MdAF3 transcription
microarray raw data can be found in supplementary material of Richardson et al. (2007 a) Hordeum vulgare
RAS3 gene transcript levels were quantified by reverse transcription-quantitative PCR (RT-qPCR) Salvia miltiorrhiza
146 UGT members expressed in at least one tissue with FPKM >0.5 Strobilanthes cusia
lncRNA000170 promoter-driven GUS transformation was carried out to examine spatial expression pattern of lncRNA000170 Solanum lycopersicum
(ATMGT5, MGT5, MRS2-6, AT4G28580) mRNA expression pattern analyzed in sepal Arabidopsis thaliana
definitions of the sampled tissues vary between experiments Oryza sativa
PpHB1 was highly expressed in bamboo shoots Phyllostachys praecox
expression of (ATICS1, EDS16, ICS1, SID2, AT1G74710) (CYP71B15, PAD3, AT3G26830) and (F6'H1, AT3G13610) was higher in PI tissues than in PU tissues Arabidopsis thaliana
grain position in spikelet did not affect expression of expansins
SrUCPA mRNA is present in all tissues and stages Symplocarpus racenosus
2.5 kb transcript ends in intergenic region between (ACCD, ATCG00500) and (PSAI, ATCG00510) Nicotiana tabacum
suppression subtractive hybridization (SSH) and microarray were used to identify differentially expressed genes linked to bud mutation Citrus sinensis
(AtLtpI-5, cdf3, LP2, LTP2, AT2G38530) gene expression confirmed to be highly tissue-specific Hordeum vulgare
F2 generation showed increase in cis × trans, cis + trans and compensatory categories Festuca pratensis; Lolium multiflorum
ZmNL4 molecular mechanism was explored using comparative transcriptome analysis Zea mays
11 of the same loci examined for expression in Oryza alta Oryza alta
431 genes identified showing significantly different expression levels between the two haplotypes of Fudingdabai Camellia sinensis
W11g023219 haplotype B harbored by 11 accessions Camellia sinensis
Spearman ranked correlations of log2-transformed transcripts per million (TPM) values indicated distinct patterns of gene expression in each cell type Oryza sativa
cbl9::CIPK3 (WT) transgenic lines were confirmed by RT–PCR Arabidopsis thaliana
(LCR77, PDF1.2, PDF1.2A, AT5G44420) probe hybridization conditions have been previously described in Berrocal-Lobo et al., 2002
white box in heat-map indicates strong down-regulation
PpRLK1 expression was significantly higher in young florets Phyllostachys praecox
PpHB1 was highly expressed in young florets Phyllostachys praecox
MdAF3 expression was markedly induced at harvest in fruits from mealy group in comparison with non-mealy group
Progeny of six independent transformants were analyzed for HT-M transcript levels Nicotiana plumbaginifolia; Nicotiana alata
Os10g34360 (YY2) was selected for RT-PCR analysis Oryza sativa
inverse correlation between the level of rescue and the PR-1 transcript expression was found in qPCR PR-1 transcript analysis Arabidopsis thaliana
rice U-box genes have full-length cDNAs Oryza sativa
ratio for SCN-inoculated and non-inoculated whole roots or root pieces is for means for biological replicates of root collections taken at the same dpi Glycine max
PpSPY was highly expressed in rhizome buds Phyllostachys praecox
PpRLK1 was highly expressed in bamboo shoots Phyllostachys praecox
qRTPCR indicated HvALMT1 was expressed at a low level relative to HvGAPDH Hordeum vulgare
cytochrome c 1 precursor gene selected as reference transcript Arabidopsis thaliana
MdAF3 transcription in mealy hybrids (M14, M55, and M48) and parental X6683 was highly induced in comparison with transcription levels observed for non-mealy hybrid (M20, AT1G18680) at harvest in 2007
differential gene expression data for five candidate proteins supported proteomic data Brassica juncea
(PR-5, PR5, AT1G75040) transcript showed transient induction in resistant variety at early time-points of mock inoculation Brassica juncea
RT-PCR analysis was performed on transgenic plants Arabidopsis thaliana
elevated expression for some of the (ACS, AT5G36880) genes observed in SCN-colonized root pieces is supported by lower but similar expression pattern observed in whole root collections Glycine max
black box in heat-map indicates strong up-regulation
PpSINA expression in rhizome buds was markedly higher than expression of PpHB1 and PpRLK1 Phyllostachys praecox
RACE and RT-PCR analysis performed on soybean cultivars Corsoy and Safrana Glycine max
cDNA SSH between regenerated pale yellow and green plants isolated nine down-regulated and 18 up-regulated genes in pale yellow plants Epipremnum aureum
transcript analysis through real-time PCR in barley shows reduction in level of transcript is conspicuous only in isoform targeted Hordeum vulgare