| herbicide-resistant 'R' samples |
form separate clusters from |
susceptible 'S' counterparts on PC2 |
Alopecurus myosuroides |
| OsbHLH92 expression in internodes |
is detected by |
GUS staining |
Oryza sativa |
| 4142 differentially expressed genes (DEGs) |
means that significant proportion of genes in |
Thalassiosira pseudonana (> 30%) changed expression as consequence of resting-cell formation |
Thalassiosira pseudonana |
| (ATAIG1, BHLH32, TMO5, AT3G25710) and (AT2G30680) expression |
is confirmed by |
RT-qPCR and ChIP-qPCR experiments on (H3.3, HTR8, AT5G10980) K27A seedlings |
Arabidopsis thaliana |
| Parametric gene set enrichment analysis (PGSEA) |
was used to understand |
the overall significant biological changes between WT and the hvtdf1-2 mutant |
Hordeum vulgare |
| metagenomics |
is advocated for examining |
potential roles of the rhizosphere microbiome in in situ gene expression |
|
| real-time quantitative polymerase chain reaction |
was used to analyze |
expression levels of PsSOC1 during chilling- and GA 3 -induced bud dormancy release |
|
| Group 4 genes |
is |
specific for interaction effects |
Arabidopsis thaliana |
| some (AMS, AT2G16910) expression |
was retained in |
the hvtdf1 mutant |
Hordeum vulgare |
| whole RNA-Seq of flower tissue from pools of diverging flower color individuals |
revealed |
strongly reduced gene expression of both annotated AhMYB2 isoforms in green flowers compared with red flowers |
Amaranthus hypochondriacus |
| GUSPlus reporter gene |
expression assays performed on |
multiple tissues and growth stages of gametophytes and sporophytes |
Pteris vittata; Ceratopteris thalictroides |
| RNA-seq analysis using laser microdissection |
was performed on roots grown in |
aerated nutrient solution without or with H₂S, or in stagnant solution |
Oryza sativa |
| relative transcript levels of their TR paralogs |
were examined in detail in |
F. tataricum and F. esculentum |
Festuca tataricum; Festuca esculentum |
| transcriptomic sequencing analysis |
was conducted on |
panicles of WT and OsOSC10 overexpression lines |
Oryza sativa |
| GO term enrichment in SlTRM5 cluster |
is shared with |
wgcna cluster containing SlTRM19/SlTRM26a |
Solanum lycopersicum |
| cRT-PCR experiments |
performed on |
edited Neopyropia yezoensis |
Neopyropia yezoensis |
| GeneYSDR001550 |
showed higher expression level in |
male tissues than in female tissues |
Spinacia oleracea L. subsp. turkestanica |
| GeneYSDR001580 |
showed higher expression level in |
male tissues than in female tissues |
Spinacia oleracea L. subsp. turkestanica |
| Endogenous NADP-ME genes |
were compared with |
expression of transgenic alleles |
Glycine max |
| RT-qPCR analysis |
was performed under |
normal conditions and recovery conditions (2 h) |
Triticum aestivum |
| (AGL61, DIA, AT2G24840) |
shows |
logFC = −4.98 |
Ipomoea purpurea |
| ∆kmt1_oPf2_B transformant |
had highest number of |
DEG |
Leptosphaeria maculans |
| no obvious trends |
detected to suggest |
Hieracium spp. cell type contigs were biased for expression in any one Arabidopsis cell type |
Hieracium praealtum; Arabidopsis thaliana |
| (ATCHS, CHS, TT4, AT5G13930) and (ANS, LDOX, TDS4, TT18, AT4G22880) genes |
highly expressed at |
stages S4 and S5 |
Quercus dentata |
| Lam1 expression |
is low in |
young panicle |
Oryza sativa |
| QuantAS |
quantifies |
changing state of isoforms |
|
| RAD51-GFP line |
enables simultaneous detection of |
RAD51-GFP mRNA and RAD51-GFP protein levels in same cells |
Arabidopsis thaliana |
| Group 2 genes |
is |
specific for bud position effects |
Arabidopsis thaliana |
| RNA-seq analysis |
was performed on |
tissues from the outer part of the root |
Oryza sativa |
| 1912 differentially expressed genes (DEGs) in (AtHMGB1, HMGB1, NFD1, AT3G51880) mutant plants compared to WT plants under HP conditions |
were identified by |
RNA-seq analysis |
Oryza sativa |
| genes meeting these criteria |
compared with |
the nucellus and its corresponding whole ovule sample |
Arabidopsis thaliana |
| temporal series of genome-wide transcriptomes |
is presented in |
this study |
Zea mays |
| individual (RLK, AT5G67280) genes |
show |
similarities and divergences in gene expression |
Arabidopsis thaliana |
| Semi-quantitative RT–PCR analysis |
uses |
gene-specific oligonucleotides F2-2CPB |
|
| RT-PCR analysis |
was used to detect |
(AOX1D, AT1G32350) expression |
Arabidopsis thaliana |
| most TFs |
barely expressed at |
green leaf stages S1–S3 |
Quercus dentata |
| RNA-seq analysis |
was performed on |
node in three conditions |
Oryza sativa |
| (DEP1, AT5G53850) promoter |
is expressed at low levels in |
leaves |
Oryza sativa |
| RNA-seq experiments |
performed to find out |
what makes guard cells special compared with other leaf cells in vascular plants |
|
| signal intensities |
are normalized and compared in |
fold change-transformed values relative to control sample |
|
| GO terms enriched in OVATE cluster |
is shared with |
SlTRM19/SlTRM26a cluster |
Solanum lycopersicum |
| 262 genes |
showed statistically significant difference in expression between |
contrasting NILs |
Capsicum annuum |
| downregulation of genes enriched in oxidoreductase acting in the NAD(P)H pathway |
was further confirmed by |
gene heatmap analysis |
Hordeum vulgare |
| RNA-seq analysis |
was performed on |
AZ and tissues immediately above (U) and below (L) it at 21 and 31 d, and AZ at 38 d |
Setaria viridis |
| ∆kmt1 mutant |
showed fewest DEG compared with |
WT strain |
Leptosphaeria maculans |
| (NFD6, AT2G20585) protein |
shows |
log-fold change of −3.97 across resistant individuals as compared to the susceptible individuals |
Ipomoea purpurea |
| Lam1 expression |
is low in |
root |
Oryza sativa |
| WGCNA clustering |
did not show much overlap among |
TRMs, OVATE, and SlOFP20 |
Solanum lycopersicum |
| transcript measurements |
were performed with |
wild-type (WT) and different almt mutant plants |
Arabidopsis thaliana |
| gene expression levels for AhCYP76AD2 and AhDODAα1 |
were similar between |
red and green bulk of biosynthesis BSA |
Amaranthus hypochondriacus |
| glasshouse experiments |
yielded |
transcriptome data |
six non-woody plant species |
| high-quality Quercus dentata genome |
combined with |
RNA sequencing |
Quercus dentata |
| slr1-d1 |
was analyzed for |
global transcriptomes |
|
| bar-coded libraries from four types of RNA |
were sequenced via |
Illumina-based technology |
Melianthus minor |
| Gene expression of transgenic malic enzyme |
was assessed over |
seed development |
Glycine max |
| signal intensity in Xenium™ analysis |
corresponds to |
transcript abundance |
|
| monolignol genes within the saccharification yield QTL |
differ by 5-fold or more between B73 and Mo17 in |
expression level |
Zea mays |
| RECT genes |
were assembled for |
specific analysis |
Mesembryanthemum crystallinum |
| 1,940 Gene Ontology (GO) terms |
contained |
135 that were linked to acclimation or responses to stimuli and stresses |
Arabidopsis thaliana |
| FaSAMDC mRNA expression levels |
significantly decreased in |
RNAi fruits |
Fragaria ananassa |
| more than 700 independent families |
showed |
57.6% overexpression |
Oryza sativa |
| Northern blot analysis |
was used to detect |
AOX isoform expression |
Arabidopsis thaliana |
| MIR reverse primer |
used for |
RT-PCR |
|
| different primers and TaqMan probes |
were designed for |
QuantAS, relative quantification, and semi-quantitative RT-PCR |
|
| mRNA-seq analysis |
was performed on |
30-d-old calli from (H3.3, HTR8, AT5G10980) and K27A lines |
Arabidopsis thaliana |
| Physcomitrium patens plants surviving G418 (Geneticin) treatment |
were analyzed by |
qPCR |
Physcomitrium patens |
| (RPL10, RPL10A, SAC52, uL16z, AT1G14320) promoter |
drives expression of |
GUS gene |
Arabidopsis thaliana |
| RNA extraction |
was used for |
transcriptomic analysis |
Populus spp.; Laccaria bicolor |
| Endogenous NAD-ME genes |
were compared with |
expression of transgenic alleles |
Glycine max |
| quantitative polymerase chain reaction analysis |
is used to measure |
gene expression levels |
Gossypium hirsutum |
| differentially regulated genes in response to red light:far-red light ratio |
grouped into |
four major groups |
Arabidopsis thaliana |
| Arabidopsis thaliana plants expressing (H3.3, HTR8, AT5G10980) K27A variant |
analysed with |
transcriptomics |
Arabidopsis thaliana |
| (DEP1, AT5G53850) promoter |
is mainly expressed in |
young panicles |
Oryza sativa |
| gene expression from bulked flower tissue |
was quantified using |
RNA-seq |
Amaranthus hypochondriacus |
| (RPL10B, uL16y, AT1G26910) promoter |
drives expression of |
GUS gene |
Arabidopsis thaliana |
| their expression levels |
were analyzed in |
tomato roots by qRT-PCR |
Solanum lycopersicum |
| 33 genes annotated in MSY region |
were detected by |
qRT-PCR |
Spinacia oleracea L. subsp. turkestanica |
| expression levels of ethylene biosynthetic and perception genes ( (ACO1, AT4G35830) (ACS2, AT-ACC2, AT1G01480) (ACS6, ATACS6, AT4G11280) NR, ETR4) and PR genes ( (AtCAPE9, ATPR1, PR 1, PR1, AT2G14610) PR-1a1, PR2b) |
were examined in |
both WT and erf.c1 mutants |
Solanum lycopersicum |
| vector-based correlation |
is used to establish |
similarity between transcripts in indices and data of interest |
|
| seed family ( (CC2, AT5G42860) vs CC5) |
is |
stronger source of variance accounting for c. 58% of total variance on (APC1, PC1, AT5G17480) |
Alopecurus myosuroides |
| RNAseq |
was used to obtain broader insight in |
transcriptional differences between contrasting NILs |
Capsicum annuum |
| Expression of the constructs in transgenic lines |
was confirmed by |
western blot and quantitative RT-PCR assays |
Arabidopsis thaliana |
| control (nonherbicide) environment |
found |
623 DETs when comparing resistant and susceptible individuals |
Ipomoea purpurea |
| Elongation factor 1-beta (Elf1b) |
served as reference gene to normalize |
expression values |
Glycine max |
| transcriptome profile analysis |
was performed as |
control |
Triticum aestivum |
| Affymetrix (ATH1, AT4G32980) Genome Arrays |
used to analyze |
transcriptome changes in response to red light:far-red light ratio |
Arabidopsis thaliana |
| GUS expression from pμ2:GUS |
detected in |
stamen |
Arabidopsis thaliana |
| GUS expression from pμ2:GUS |
detected in |
developing siliques |
Arabidopsis thaliana |
| SlTRM17/20a and SlTRM19 in developing fruit tissues |
despite highest expression in |
developing fruit tissues, these genes were correlated with two to five OFPs respectively but only during floral development |
Solanum lycopersicum |
| putative cost loci |
should be |
differentially expressed in the absence of herbicide |
Ipomoea purpurea |
| OsbHLH92 expression in lamina joints |
is detected by |
GUS staining |
Oryza sativa |
| results of PGSEA |
exhibited |
specific expression patterns for each process |
Hordeum vulgare |
| GUS expression from pμ2:GUS |
detected in |
pollen |
Arabidopsis thaliana |
| SlTRM3/4 in fruit development |
showed highest correlation with |
two OFPs (SlOFP7 and SlOFP10) |
Solanum lycopersicum |
| changing trend of isoforms in different tissues and treatments |
is consistent |
between methods |
|
| QuantAS |
is superior to semi-quantitative RT-PCR in terms of |
accuracy, compatibility, and specificity |
|
| transcriptomic analysis of Syntrichia ruralis |
sequenced |
average of 16 million reads per replicate (n = 3) per condition |
Syntrichia ruralis |
| lrx mutants |
show reduced |
amplification of sequences 3′ of insertion sites |
Arabidopsis thaliana |
| Affymetrix 57K rice genome chip |
was employed to assess |
pollen expression profile of suspected allergens |
Oryza sativa |
| chloroplast genes |
were co-regulated as suggested by |
hierarchical cluster analysis of expression patterns |
Arabidopsis thaliana |
| WGCNA |
reflected |
specific spatial-temporal expression by grouping OFPs and TRMs in clusters of co-expressed genes |
Solanum lycopersicum |
| GO terms enriched in OVATE cluster |
are shared with |
SlTRM5 cluster |
Solanum lycopersicum |
| AS isoforms that are easily detected by RT-PCR |
are provided as examples for comparison of |
QuantAS and RT-PCR |
|
| heatmap of enriched pathways |
showed |
some of them showed delayed expression rather than downregulation |
Hordeum vulgare |
| reduced expression of CaPtr1 and CaZAR1 in CaPtr1-CaZAR1-VIGS peppers |
was measured by |
quantitative RT-PCR |
Capsicum annuum |
| mRNA abundances of chloroplast- and nuclear-encoded subunits of the cyt-bf |
were compared between |
young and mature wild-type leaves |
Nicotiana tabacum |
| genes differentially expressed 5-fold or greater in QTL8 |
number |
29 |
Zea mays |
| PP2AB′1 expression |
was confirmed by |
quantitative reverse transcriptase (qRT)-PCR |
Medicago truncatula |
| whole ovary tissues |
were used |
transcriptomic analysis |
Hieracium spp. |
| GO enrichment analysis and PAGE |
closely correspond |
observed GO term enrichments |
|
| non-competitive RT–PCR |
is used to detect |
gene transcripts |
|
| histone gene H3.2 |
used as |
control |
Arabidopsis thaliana |
| RNA sequencing |
was performed on |
ectomycorrhizas |
Populus spp.; Laccaria bicolor |
| pOp:WUS leaky expression |
is confirmed by |
expression levels of (PGA6, WUS, WUS1, AT2G17950) and (AtCLV3, CLV3, AT2G27250) |
Arabidopsis thaliana |
| transcriptomic data from active and dormant axillary buds |
subjected to |
co-expression analyses |
Arabidopsis thaliana |
| Group 1 genes |
is |
specific for R:FR effects |
Arabidopsis thaliana |
| real time PCR and parallel reaction monitoring (PRM) measurements |
revealed |
strong reduction of man1A mRNA beneath the detection limit |
Chlamydomonas reinhardtii |
| total RNA |
isolated and analyzed using |
RNA hybridization with different probes |
|
| red color in transcript analysis visualization |
marks |
up-regulation of transcript abundance |
Arabidopsis thaliana |
| transcript abundances of (PETB, ATCG00720) and (PETD, ATCG00730) |
were not reduced |
mature leaves |
Nicotiana tabacum |
| anther tissues |
were selected for Y2H screening based on |
similarities in expression profiles from qPCR and western analysis |
Oryza sativa |
| transgenic lines |
expressed higher levels compared to |
control plants |
Arabidopsis thaliana |
| ABI 7300 real-time PCR system |
used for |
two-step RT–PCR |
|
| RNA analysis |
was performed using |
gene-specific probes |
|
| H3.2 replacement histone variant gene (HTR6, AT1G13370) |
increased expression confirmed by |
RT-PCR in independent leaf samples of msi1-cs plants |
Arabidopsis thaliana |
| PHT4;6 gene |
amplified by |
PCR |
|
| atTIC55-II specific primers |
used for amplification of |
atTIC55-II |
|
| pKIN17::GUS transgenic lines |
show |
(AtKIN17, KIN17, AT1G55460) spatial and temporal expression pattern |
Arabidopsis thaliana |
| temperature sensitization hypothesis |
required additional validation by |
transcriptome profiling |
Arabidopsis thaliana |
| developing internodes 4 and 5 of greenhouse-grown (B73, CHL6, CNX, CNX1, SIR4, AT5G20990) and Mo17 parents |
were used for |
expression analysis (RNA sequencing) |
Zea mays |
| 16 out of 20 genes |
confirmed by |
RT–PCR |
Arabidopsis thaliana |
| reverse transcription PCR analyses |
used to detect |
paternal transcripts |
Oryza sativa |
| RT-PCR using primers flanking insertion site |
amplifies product of predicted size from |
SMT15 complementary DNA (cDNA) from wild-type RNA |
Chlamydomonas reinhardtii |
| (CYP707A3, AT5G45340) transcripts |
were detected in |
RNA-seq analyses |
Arabidopsis thaliana |
| seed transcriptome |
showed little correlation with |
seed proteome |
Arabidopsis thaliana |
| RNA-seq |
is more robust and sensitive in |
identifying transcript units even at low levels of expression |
|
| Northern blot analysis |
indicated |
transgenic lines expressed higher transcript levels |
Arabidopsis thaliana |
| primer P-6 (5′-ACTGCCATCGCCAAGAGC-3') |
used in |
RT–PCR analysis |
|
| Tubulin-F and R primers |
used as control for |
RT-PCR analysis |
|
| HvCSLC gene |
expression measured by |
quantitative PCR (qPCR) |
Hordeum vulgare |
| MAIF1 promoter–GUS transgenic plants |
used to determine |
MAIF1 expression patterns |
|
| each determination |
includes |
three biological replicates |
Arabidopsis thaliana |
| OsMED14_1 promoter |
fused upstream of |
β-glucuronidase (GUS; uidA) gene |
Oryza sativa |
| NanoString Technology |
is suitable for measurements with |
multiple time points |
Arabidopsis thaliana |
| set of genes for interrogation |
included mRNA for |
all proteins that had shown a change in response to Fe deficiency |
Arabidopsis thaliana |
| UGT, cytokinin oxidase, phenazine biosynthesis, aspartic protease, purple acid phosphatase, and type A response regulator-like genes |
were verified by |
RNA isolation from apomict Hieracium R35 ovaries and resequencing |
Hieracium praealtum |
| C-Lectin and SD-3 subfamilies |
are excluded from |
expression divergence analysis |
|
| microarray analysis |
identified |
candidate genes with consistent changes |
Arabidopsis thaliana |
| genes not meeting this criterion |
were called |
not detected |
Arabidopsis thaliana |
| leaf tissue |
RNA extracted from |
RNA |
|
| qPCR amplification |
performed using |
method described by Burton et al. (2008) |
Hordeum vulgare |
| RNA-seq comparison of transcriptomes |
identified |
genes and pathways with significantly different basal expression strengths |
Schrenkiella parvula; Arabidopsis thaliana |
| PsaD mRNA |
accumulation was determined by |
northern-blot analyses |
Nicotiana tabacum |
| Qualitative RT–PCR results |
partially agree with |
published transcript expression data |
Arabidopsis thaliana |
| fold change of given stages compared to 3 DAF |
Log2 transformed in |
hierarchical analysis |
Brassica napus |
| WRKY-like sequence |
is highly expressed in |
Mo17 |
Zea mays |
| TcGLIP expression |
is verified by |
quantitative reverse transcription PCR (qRT-PCR) |
Tanacetum cinerariifolium |
| set of genes for interrogation |
was complemented with |
genes encoding major Fe binding protein subunits |
Arabidopsis thaliana |
| GO:0009631, cold acclimation |
was |
term with highest mean log2-FC and identical with persistently correlated term |
Arabidopsis thaliana |
| observed GO term enrichments |
are independent of |
arbitrary p-value or fold change thresholds |
|
| genes meeting this criterion |
were considered |
expressed |
Arabidopsis thaliana |
| RT–PCR |
indicated that relative transcript expression in Arabidopsis was moderate for |
(GAUT3, AT4G38270) (GAUT5, LGT5, AT2G30575) (GAUT6, AT1G06780) (GAUT10, LGT4, AT2G20810) (GAUT14, AT5G15470) and (GAUT15, AT3G58790) |
Arabidopsis thaliana |
| seedlings |
total RNA was extracted from |
total RNA |
|
| percentages of increase in gene expression |
were normalized to |
average values for each individual seedlings adapted in darkness |
|
| Fragaria vesca L. (spp. vesca forma alba (Her.) Staudt, white fruits) |
is used for |
real-time quantitative PCR |
Fragaria vesca |
| sulfate transporter genes |
analyzed by |
semi-quantitative RT–PCR |
|
| Gene Expression Analysis for iCycle iQ® Real Time PCR Detection System software |
uses method derived from |
algorithms outlined by Vandesompele et al. (2002) |
Vitis vinifera |
| known (MIR159, MIR159A, AT1G73687) and (MIR319, MIR319B, AT5G41663) targets |
expression was determined using |
qRT-PCR |
Arabidopsis thaliana |
| PoGT43A |
amplified by PCR primers |
PCR primers 5'-gttcgatcctttgggatcctgaga-3' and 5'-tcatagttttctcctgctagcatc-3' |
Populus trichocarpa |
| developing xylem tissues |
used for |
total RNA isolation |
|
| high-quality RNA-seq reads |
were mapped onto |
FER_r1.1.pseudomolecule reference |
Ficus erecta |
| 24 CYP genes |
exhibited significantly higher expression levels in |
leaf and stem than in root |
Strobilanthes cusia |
| 468 genes |
were identified in |
both generations |
Festuca pratensis; Lolium multiflorum |
| quantitative reverse transcriptase (qRT)-PCR |
was performed to address |
biological function of (PSS1, AT3G59640) |
Arabidopsis thaliana |
| DEGs between wild type and fc mutants at beginning of deetiolation |
were analyzed using |
GSLA and other tools |
Arabidopsis thaliana |
| Genevestigator Version 3 |
was used to perform |
Meta-Profile Analysis for transcript analysis |
Arabidopsis thaliana |
| mature leaves after 7 d of RNA induction |
more RNA had to be loaded to obtain detectable signals of |
nuclear-encoded genes |
Nicotiana tabacum |
| immunoblot analyses |
confirmed |
target gene silencing |
Kalanchoe fedtschenkoi |
| 35S::HWS plants |
displayed |
miRNA target enrichment |
Arabidopsis thaliana |
| TcADH1 expression |
is verified by |
quantitative reverse transcription PCR (qRT-PCR) |
Tanacetum cinerariifolium |
| strong reduction of man1A mRNA |
confirmed on |
protein level |
Chlamydomonas reinhardtii |
| transgenic plants harboring (EMF1, AT5G11530) promoter::glucuronidase (GUS) reporter gene |
displayed differential GUS activity in |
vegetative and flower tissues |
Arabidopsis thaliana |
| green color in transcript analysis visualization |
marks |
down-regulation of transcript abundance |
Arabidopsis thaliana |
| Among the plastid-encoded genes, only the mRNA abundances of (PETG, ATCG00600) and petN |
were significantly decreased in |
mature leaves |
Nicotiana tabacum |
| (AtKIN17, KIN17, AT1G55460) mRNA levels |
are relatively more moderate in |
seedlings, siliques, and roots |
Arabidopsis thaliana |
| RNA-seq analysis |
was performed on |
apices of Chasselas Dore and Chasselas Ciotat growing shoot tips |
Vitis spp. |
| qRT-PCR analysis results |
were generally consistent with |
read frequencies from transcriptomic profiling experiments |
Tanacetum cinerariifolium |
| enrichment analysis |
assessed |
enrichment of up- or down-regulation among gene sets of 1,940 Gene Ontology (GO) terms |
Arabidopsis thaliana |
| functional enrichment analysis |
applied to |
all included 1,940 GO terms |
Arabidopsis thaliana |
| expression patterns within (RLK, AT5G67280) subfamilies |
were analyzed for conservation or divergence using |
Pearson correlation coefficient metric |
|
| tubulin |
was used as |
loading control |
Arabidopsis thaliana |
| RT-PCR primers |
could amplify |
four different N. tabacum myosin XI genes and one myosin VIII gene |
Nicotiana tabacum |
| three LRR XIII subfamily members with known functional overlaps |
have expression profiles that are |
similar |
|
| RNAs |
subjected to |
RT–PCR |
Oryza sativa |
| homozygote T3 generation Shengkang No. 1 lines |
subjected to |
Semi-Quantitative RT–PCR Analysis |
|
| 22 of these proteins |
had mRNA levels significantly changed in |
at least one of the 16 selected microarray datasets |
|
| (CYP707A1, AT4G19230) transcripts |
were detected in |
RNA-seq analyses |
Arabidopsis thaliana |
| (AIRP3, AtAIRP3, LOG2, AT3G09770) value of at least 1 |
is used as cutoff to select |
differentially expressed transcripts |
Arabidopsis thaliana |
| TcADH2 expression |
is verified by |
quantitative reverse transcription PCR (qRT-PCR) |
Tanacetum cinerariifolium |
| embryo axes |
used for |
real-time quantitative PCR analysis |
Medicago truncatula |
| average-linkage hierarchical clustering |
based on |
average-linkage gene expression distances |
|
| barley cDNA collection |
used as template for |
HvCSLC gene expression measurement |
Hordeum vulgare |
| qPCR analysis |
compared |
FT and (AGL9, SEP3, AT1G24260) transcript levels over time |
Arabidopsis thaliana |
| 15 GAUT genes |
were analyzed using |
RT–PCR |
|
| NbCOMT |
examined using |
gene-specific primers |
|
| strict consensus de novo approach |
is supported by |
finding of 19 genes significantly regulated by ABA through qPCR |
Physcomitrella patens |
| RNA |
extracted from |
roots and shoots of 6-day-old seedlings |
Arabidopsis thaliana |
| pair of (ATFH8, FH8, FORMIN 8, AT1G70140) specific primers (forward: CAGTTTCGATGGCGATTTAATGGAA; reverse: TGAGCACAATCGCTGTGTTTT GAGA) |
was used to conduct |
standard RT–PCR |
Arabidopsis thaliana |
| RNA sequencing (RNA-seq) |
identified |
differentially expressed genes (DEGs) |
Oryza sativa |
| (CYP707A2, AT2G29090) transcripts |
were detected in |
RNA-seq analyses |
Arabidopsis thaliana |
| RT–PCR |
indicated that relative transcript expression in Arabidopsis was low for |
(GAUT2, LGT2, AT2G46480) (GAUT7, LGT7, AT2G38650) (GAUT11, AT1G18580) and (GAUT13, AT3G01040) |
Arabidopsis thaliana |
| GUS expression from pμ2:GUS |
detected in |
dark-grown hypocotyls |
Arabidopsis thaliana |
| GUS expression from pμ2:GUS |
detected in |
rosette leaves |
Arabidopsis thaliana |
| Quantitative real-time reverse transcription PCR (qRT-PCR) |
is used to study |
gene expressions |
Brassica napus |
| in situ hybridization |
was used to analyze |
TaeSultr1;1 spatial expression |
Triticum aestivum |
| NbCCR |
examined using |
gene-specific primers |
|
| upregulated DEGs in present study |
overlap with |
upregulated DEGs in Koussevitzky et al. (2007) |
Arabidopsis thaliana |
| Zhao et al. (2019b) study |
performed RNA sequencing in |
gun1-9 mutant |
Arabidopsis thaliana |
| total RNAs |
were extracted from |
different plant organs and tissues |
Nelumbo nucifera |
| abundance of the nuclear-encoded (PETC, PGR1, AT4G03280) and (PetM, AT2G26500) mRNAs |
was clearly decreased |
mature leaves |
Nicotiana tabacum |
| (ATGRP7, CCR2, GR-RBP7, GRP7, RBGA3, SRBP1, AT2G21660) and (AtSOD1, CSD1, SOD1, AT1G08830) |
are absent in comparison of |
MIM156 to Col-0 |
Arabidopsis thaliana |
| gene expression levels |
were compared using |
two complementary approaches |
|
| Tubulin loading control |
was amplified using |
Tubulin-specific primers |
|
| Fra a 1e 5′-UTR |
amplified by |
qPCR with specific primers |
Fragaria × ananassa |
| TaeSultrt2;1 |
shows no expression in |
wheat grains |
|
| T-DNA insertion lines |
were tested for |
transcript abundance |
|
| NbCesA6 |
examined using |
gene-specific primers |
|
| PipCoA ligase transcripts |
were virtually non-existent in |
roots |
Piper nigrum |
| cDNA |
substrate for |
qPCR analysis |
Fragaria × ananassa |
| wheat (Triticum aestivum) root sections |
processed for |
in situ hybridization |
Triticum aestivum |
| ΔCt = Ct Target – Ct Ubiquitin |
was used to obtain |
normalized expression of VvMYC1 |
Vitis vinifera |
| thermal cycle program |
includes |
95°C for 15 min initial denaturation |
Arabidopsis thaliana |
| RNA-seq reads |
over 88% aligned to |
Strobilanthes cusia genome uniquely |
Strobilanthes cusia |
| PCA and hierarchical cluster analyses |
showed distinct separation at |
transcriptome level |
Oryza sativa |
| putative families |
were used for |
co-expression analyses |
Arabidopsis thaliana |
| ACTIN primers |
is used as control to determine |
uniformity of cDNA concentration |
|
| variable amounts of total RNA from Mn1 and mn1 endosperm |
shows greater steady state level of |
(TAR1, AT1G23320) RNA in mn1 kernels |
Zea mays |
| actin |
is amplified in |
RT-PCR process with 25 cycles |
|
| transketolase-2 gene |
transcript levels were quantified by |
reverse transcription-quantitative PCR (RT-qPCR) |
Salvia miltiorrhiza |
| Richter et al. (2020) study |
reported NF-responsive transcriptome changes in |
gun1-1 mutant |
Arabidopsis thaliana |
| 307 genes |
were |
downregulated after cold stress treatment compared with control conditions |
Festuca pratensis; Lolium multiflorum |
| nodule centered expression of GmSPX5 |
was verified through |
GUS staining in transgenic soybean plants harboring Pro GmSPX5:GUS |
Glycine max |
| (CCZ1a, AT1G16020) gene |
transcript levels were confirmed by |
quantitative real-time PCR (RT-qPCR) |
Arabidopsis thaliana |
| Klie et al. |
analyzed |
transcriptome profiles from Arabidopsis |
Arabidopsis thaliana |
| nuclear signal |
can be used to extract |
gene expression |
|
| pair of (ATFH8, FH8, FORMIN 8, AT1G70140) specific primers (forward: CAGTTTCGATGGCGATTTAATGGAA; reverse: TGAGCACAATCGCTGTGTTTT GAGA) |
was used to conduct |
fluorescence quantitative PCR |
Arabidopsis thaliana |
| RNA-seq analysis |
did not find differences in |
distribution of sequence reads in 5′ → 3′ direction in gene body between cur1 and WT |
Oryza sativa |
| leaf tissue |
collected and quick frozen for |
RNA isolation |
|
| Phenylalanine Ammonia-Lyase (ZmPALb) |
analyzed using |
gene-specific primers |
Zea mays |
| Nb4CL |
examined using |
gene-specific primers |
|
| Fragaria chiloensis (spp. chiloensis forma patagonica, red fruits) |
is used for |
real-time quantitative PCR |
Fragaria chiloensis |
| normalized expression of VvMYC1 gene |
was calculated using |
Gene Expression Analysis for iCycle iQ® Real Time PCR Detection System software |
Vitis vinifera |
| ZmCesA5 |
analyzed using |
gene-specific primers |
Zea mays |
| ZmCesA9 |
analyzed using |
gene-specific primers |
Zea mays |
| (ANAC059, ATNAC3, NAC3, ORS1, AT3G29035) promoter |
fused to |
β-glucuronidase (GUS) reporter gene |
Arabidopsis thaliana |
| PtdCesA8A-specific forward and reverse primers |
used for |
semi-quantitative RT-PCR experiments |
|
| pairwise transcriptome comparisons |
identified |
differentially expressed genes (DEGs) with fold change >2 and FDR <0.05 |
Prunus persica |
| expression of anthocyanin biosynthetic genes and transcription factors |
was validated by |
qPCR analysis |
Prunus persica |
| quantitative PCR |
uses |
200 nM oligonucleotides |
Arabidopsis thaliana |
| 100 mg of 7-day-old seedlings |
was used to extract |
RNA |
Arabidopsis thaliana |
| hierarchical clustering analysis of 907 DEGs |
showed |
significant upregulated and downregulated genes in fruit stored at 16°C |
Prunus persica |
| 240 CYPs |
expressed with |
FPKM >0.5 in at least one sample |
Strobilanthes cusia |
| NF-treated (ABAR, CCH, CCH1, CHLH, GUN5, AT5G13630) mutant |
shows more downregulated DEGs and larger changes than |
other mutants |
Arabidopsis thaliana |
| NbCesA8 |
examined using |
gene-specific primers |
|
| whole-gene translational fusions with reporter genes |
revealed |
broad extent of (ATSUC1, SUC1, AT1G71880) and (ATSUC9, SUC9, AT5G06170) expression |
Arabidopsis thaliana |
| NF-treated (GUN1, AT2G31400) and (ABAR, CCH, CCH1, CHLH, GUN5, AT5G13630) mutants |
show overlap of DEGs with |
Richter et al. (2020) study |
Arabidopsis thaliana |
| Fudingdabai haplotype B of W03g008694 |
was significantly higher than |
Fudingdabai haplotype A of W03g008694 |
Camellia sinensis |
| line OX.ALMT1-1 |
had |
23-fold higher transcript levels of (ALMT1, ATALMT1, AT1G08430) than WT (P-value < 0.01) |
Arabidopsis thaliana |
| shoot genes |
were grouped into |
eight clusters |
Noccaea caerulescens |
| biosynthetic pathways |
were characterized via |
targeted transcriptomics by bait-gene co-expression analysis |
|
| Northern analysis |
performed on |
leaf tissue from ethylene-treated plants |
|
| (YUC, YUC1, AT4G32540) RNA |
is detected at all levels of loading with |
much longer X-ray film exposure |
Zea mays |
| ACL1 |
is amplified in |
RT-PCR process with 35 cycles |
|
| semi-quantitative RT-PCR |
was performed on |
total RNA extracted from stems |
|
| M171 clone |
had |
582 differentially expressed genes (DEGs) |
Vitis vinifera |
| DEGs in (GUN1, AT2G31400) mutant |
show good overlap in |
both gun mutants |
Arabidopsis thaliana |
| (CDC73, PHP, AT3G22590) and elF2B transcripts |
were checked for being expressed fairly equal among |
different organs |
Piper nigrum |
| DPS gene |
transcript levels were quantified by |
reverse transcription-quantitative PCR (RT-qPCR) |
Salvia miltiorrhiza |
| ten (LEA, AT2G21490) genes from different groups |
were selected to determine expression pattern by |
real-time PCR (RT-PCR) analysis |
Acer truncatum |
| Festuca homoeologs |
is predominantly being modified in genes exhibiting |
highest expression level changes |
Festuca pratensis; Lolium multiflorum |
| single-cell studies |
have revealed remarkable variation in |
population-level gene expression in Pseudomonas syringae |
Pseudomonas syringae |
| EST data |
may be |
especially non-uniform |
Oryza sativa |
| spike in (ACS, AT5G36880) gene expression at 2 dpi |
often occurs in |
both inoculated and non-inoculated roots |
Glycine max |
| transcript size of 1500-2000 nucleotides |
is larger than |
expected 1033 nucleotides |
Nicotiana tabacum |
| (ATWRKY34, MSP3, WRK34, WRKY34, AT4G26440) expression and subcellular localization in response to cold stress |
was investigated using |
promoter–GUS analysis |
Arabidopsis thaliana |
| in situ hybridization results |
reflect |
results observed by qRT-PCR analysis |
Agave tequilana |
| Fragaria vesca L. (Reina de los Valles, red fruits) |
is used for |
real-time quantitative PCR |
Fragaria vesca |
| atakt1-2 line |
were analyzed for |
(ATHAK5, HAK5, AT4G13420) expression |
Arabidopsis thaliana |
| up-regulated genes |
defined as |
genes with greater than or at least two-fold linear intensity ratio |
|
| poplar stems |
total RNA isolated from |
total RNA |
Populus trichocarpa |
| (TAT, TAT3, AT2G24850) gene |
transcript levels were quantified by |
reverse transcription-quantitative PCR (RT-qPCR) |
Salvia miltiorrhiza |
| SST gene expression in Pna-10 |
is statistically significantly higher than |
SST gene expression in Pna-17 |
|
| primers MYCF2s and MYCR3s |
amplify |
159-bp PCR-fragment from VvMYC1 |
Vitis vinifera |
| PoGT8D-2 |
amplified by PCR primers |
PCR primers 5'-tcgagcaaagccttggctagatatagc-3' and 5'-tcatgtcctaatatgacagcccgtaat-3' |
Populus trichocarpa |
| RNA-seq analysis |
obtained |
135 million RNA-seq reads from four samples |
Ficus erecta |
| glucosidase II β-subunit gene |
has highly similar expression pattern to |
(ERD2B, AT3G25040) |
Arabidopsis thaliana |
| ZmCesA12 |
analyzed using |
gene-specific primers |
Zea mays |
| four different statistical methods |
obtained |
high confidence and statistically significant dataset for differentially expressed genes |
Triticum aestivum |
| grain and stem/rachis sections |
processed for |
in situ hybridization |
Triticum aestivum |
| VvMYC1 transcript levels |
were measured using |
iCycler iQ® (Bio-Rad) |
Vitis vinifera |
| PtdCesA4A-specific forward and reverse primers |
used for |
semi-quantitative RT-PCR experiments |
|
| Fra a 2 gene |
expression investigated using |
qPCR with specific primers |
Fragaria × ananassa |
| VvMYC1 expression |
was normalized to |
transcript level of VvUbiquitin1 |
Vitis vinifera |
| each determination |
includes |
three technical repeats |
Arabidopsis thaliana |
| subset of 394 genes differentially expressed in both HRS and HS treatments and during both days 1 and 11 of heat treatment |
was analyzed |
further for functional enrichment |
Chenopodium quinoa |
| reverse transcriptase (RT)–polymerase chain reaction (PCR) |
analyzes |
transcript population |
Setaria viridis |
| FPN3p-GUS construct |
is transformed into |
wild-type Arabidopsis |
Arabidopsis thaliana |
| single-cell approaches |
can increase |
spatial and temporal resolution of developmental and adaptive processes |
|
| TRAP-seq |
enables mapping of |
translating RNAs in specific cell and organ types |
|
| Fra a 3 3′-UTR |
amplified by |
qPCR with specific primers |
Fragaria × ananassa |
| RNA extraction and RNA gel-blot analyses |
is used for |
gene expression detection |
|
| (AtMYB97, MYB97, AT4G26930) |
continually failed to be detected in |
wild-type plants |
Arabidopsis thaliana |
| total RNA |
isolated using |
Macherey and Nagel extraction method |
Arabidopsis thaliana |
| Ghd8 |
amplified by |
primer pair C8dsF and C8dsR |
|
| genes differentially expressed exclusively in the treatments with yield loss (HRS and HS) |
were analyzed |
further to associate gene expression with yield loss |
Chenopodium quinoa |
| 10,981 DEGs |
were identified between |
16°C and 0°C, 5°C, 8°C, 12°C temperature treatments |
Prunus persica |
| 27,479 genes |
detected with |
expression levels of FPKM ≥0.5 in at least one sample |
Strobilanthes cusia |
| 1314 upregulated and 1965 downregulated genes |
shared by |
leaf (L1 and L4) and stem (S1 and S2) |
Strobilanthes cusia |
| parental expression levels |
accounted for |
4,443 and 4,239 genes in Festuca × Lolium and Lolium × Festuca hybrids |
Festuca pratensis; Lolium multiflorum |
| overlap of genes in ELD categories between F1 and F2 generations |
increased from |
60.3% in young hybrids to 67.5% in hybrids after 4 years of cultivation to 83.1% in hybrids after cold stress |
Festuca pratensis; Lolium multiflorum |
| K-mean clustering of 4155 differentially expressed transcripts |
partitioned genes into |
six clusters associated with cell types |
Oryza sativa |
| α-tubulin reverse primer |
used for |
RT-PCR |
|
| GUS assays |
were performed for |
transgenic Arabidopsis plants |
Arabidopsis thaliana |
| PipCoA ligase gene expression |
was lower in |
light green and very young fruits (1 month post anthesis) |
Piper nigrum |
| nine hybrid plants together with parents |
were used for |
analysis of gene expression |
Festuca pratensis; Lolium multiflorum |
| different lines |
grouped secondly by |
genotype |
Solanum lycopersicum |
| electronic fluorescent pictograph (eFP) browser |
has been used to visualize |
Arabidopsis gene expression data |
Arabidopsis thaliana |
| whole-genome arrays |
make it possible to pursue |
detailed questions about gene expression |
Medicago truncatula |
| UGT, purple acid phosphatase, and type A response regulator-like genes |
showed enrichment in |
AI laser-captured samples |
Hieracium praealtum |
| RT-qPCR-based expression profiling |
was performed on |
senescence-associated genes, chlorophyll degradation genes, and ABA biosynthesis and signaling genes |
Solanum lycopersicum |
| RT-PCR analysis |
was performed on |
total RNA from wild-type and pht4;6-1 seedlings |
Arabidopsis thaliana |
| reverse transcription–PCR analysis |
uses |
2 μg of total RNA |
|
| quality-controlled microarray data |
analyzed using |
GeneSpring GX software |
|
| cluster CV |
contained |
972 genes preferentially expressed in veinal cells |
Oryza sativa |
| line OX.ALMT1-2 |
had |
105-fold higher transcript levels of (ALMT1, ATALMT1, AT1G08430) than WT (P-value < 0.05) |
Arabidopsis thaliana |
| root genes |
were grouped into |
seven clusters |
Noccaea caerulescens |
| 4-Coumarate CoA Ligase (Zm4CLa) |
analyzed using |
gene-specific primers |
Zea mays |
| Hydroxycinnamoyl-CoA shikimate/quinate hydroxycinnamoyl Transferase (ZmHCT) |
analyzed using |
gene-specific primers |
Zea mays |
| novel promoter:reporter gene fusion |
can determine |
spatial and temporal aspects of gene expression |
|
| Nr mutant |
has higher number of differentially expressed genes (DEGs) compared to |
etr3-ko mutant |
Solanum lycopersicum |
| nodule centered expression of GmSPX5 |
was verified through |
quantitative reverse transcription-PCR (qRT-PCR) analysis |
Glycine max |
| haplotype-resolved accessions |
provide |
helpful resource to investigate ASE genes |
Camellia sinensis |
| Cucumis metuliferus CM27 genes |
were confirmed by |
RNA-sequencing (RNA-seq) |
Cucumis metuliferus |
| cluster CBS |
contained |
285 genes preferentially expressed in bundle sheath cells |
Oryza sativa |
| OX.STOP1-1 line |
had |
(ALMT1, ATALMT1, AT1G08430) transcript levels 10-fold higher than in WT (P-value < 0.01) |
Arabidopsis thaliana |
| single-cell RNA-sequencing and spatial transcriptomics |
enable analysis of |
developmental and adaptive processes at single-cell resolution |
|
| (ACS, AT5G36880) genes with the highest relative expression in the whole root RNA samples |
were mostly for genes that did not increase in |
SCN-colonized roots |
Glycine max |
| starch-branching enzyme class II (sbe2-1) |
has average Cy5/Cy3 ratio of |
5.5 |
Phyllostachys praecox |
| starch-branching enzyme I (Rbe1) |
has average Cy5/Cy3 ratio of |
5.5 |
Phyllostachys praecox |
| similarity of expression patterns between microarray and qRT-PCR |
suggests |
expression differences unlikely due to polymorphisms |
Solanum tuberosum |
| quantitative real-time PCR data |
were collected and analyzed using |
Rotor Gene 6.0 software |
|
| SST gene expression |
was measured by |
real-time RT-PCR |
|
| transgenic plants |
used for |
expression analysis of the GUS reporter gene |
Arabidopsis thaliana |
| RT-PCR analysis |
measures expression of |
ACL2 (ACETYL-COA LIGASE 2) |
|
| quantitative PCR |
uses |
fivefold diluted cDNA |
Arabidopsis thaliana |
| downregulated DEGs in present study |
overlap with |
downregulated DEGs in Koussevitzky et al. (2007) |
Arabidopsis thaliana |
| total expression level of homoeologous gene pairs in hybrids |
compared with |
expression level of their two parents |
Festuca pratensis; Lolium multiflorum |
| Lolium expression dominance |
remained almost the same after |
4 years of cultivation |
Festuca pratensis; Lolium multiflorum |
| both homoeologs |
were upregulated in |
11 (7.3%), 12 (6.6%), and 21 (11.4%) genes in category II |
Festuca pratensis; Lolium multiflorum |
| expression biases between two subgenome homoeologs |
reduces |
feasibility of coexpression analysis |
Triticum turgidum |
| Both constructs, along with pUbi-GUS |
were co-transformed by |
biolistic bombardment into maize endosperms |
Zea mays |
| BAR expression databases |
contain |
detailed expression analyses |
Arabidopsis thaliana; Populus trichocarpa; Triticum aestivum; Oryza sativa |
| transcriptional activity of TNP2-like transposase genes |
is differentiated in |
B. rapa and B. oleracea |
Brassica rapa; Brassica oleracea |
| highly expressed Fudingdabai alleles of these three genes |
showed higher expression levels than |
other alleles in some Fudingdabai relatives |
Camellia sinensis |
| OX.STOP1-1 line |
had |
MATE transcript levels 4-fold higher than in WT (P-value < 0.05) |
Arabidopsis thaliana |
| overlap of genes in categories between F1 and F2 |
increased from |
60.3% to 67.5% |
Festuca pratensis; Lolium multiflorum |
| seven of the 10 WGD pairs of Dof genes in rice |
had sufficient data to assess in |
RiceXPro database |
Oryza sativa |
| 702 genes responding significantly differently to cadmium exposure between accessions |
were identified when considering |
direction and magnitude of gene expression changes |
Noccaea caerulescens |
| (HCC1, AT3G08950) (HOMOLOGUE OF COPPER CHAPERONE SCO) expression in juvenile leaves |
is consistent with |
Genevestigator expression database |
Arabidopsis thaliana |
| AtProT transcript levels |
were determined in |
tissues where high expression of the respective gene had been shown |
Arabidopsis thaliana |
| (DFR, M318, TT3, AT5G42800) expression level |
was higher in |
overexpression seedlings than in wild-type |
Arabidopsis thaliana |
| pattern of gene expression of LsPIP2 gene |
was different in |
shoots and roots |
|
| (ASUS1, atsus1, SUS1, SUSY1, AT5G20830) transcript |
is lowest in |
cauline leaves and stem |
Arabidopsis thaliana |
| clones from suppression subtractive hybridization |
were printed on |
microarray |
Citrus sinensis |
| 981 and 1,173 genes |
displayed |
transgressive expression |
Festuca pratensis; Lolium multiflorum |
| transgressive expression |
with downregulation being more frequent than |
upregulation |
Festuca pratensis; Lolium multiflorum |
| Lolium homoeolog |
was upregulated in |
3 (2.0%), 6 (3.3%), and 5 (2.7%) genes in category II |
Festuca pratensis; Lolium multiflorum |
| expression biases among three sub-genome homoeologs |
makes |
coexpression analysis |
Triticum aestivum |
| effector–reporter construct and internal construct |
were co-transformed into |
maize endosperm |
Zea mays |
| OX.STOP1-2 line |
presented |
(AtSTOP1, STOP1, AT1G34370) transcript levels 4 times higher than WT (P-value < 0.01) |
Arabidopsis thaliana |
| transgenic T2 seedlings |
source of |
total RNA from whole 7-day-old seedlings |
|
| VvMYC1 |
transcript levels measured by |
qPCR |
Vitis vinifera |
| Northern blot analysis |
confirms |
q-PCR data |
Zea mays |
| ZmCesA8 |
analyzed using |
gene-specific primers |
Zea mays |
| Caffeic acid O-MethylTransferase (ZmCOMT) |
analyzed using |
gene-specific primers |
Zea mays |
| RNA |
was isolated from |
stage 12 flowers |
Arabidopsis thaliana |
| number of DEGs identified in 0°C, 5°C, 8°C, and 12°C relative to 16°C |
gradually decreased from |
0°C to 12°C |
Prunus persica |
| CK2B1-promoter–β-glucuronidase (GUS) reporter |
revealed |
CK2B1 expression in all tissues of seedlings |
Arabidopsis thaliana |
| transcriptome analysis |
profiled |
spatio-temporal expressions of genes across different tissues |
Strobilanthes cusia |
| dedicated qPCR array |
applied to |
fruits at three different stages of development |
Solanum lycopersicum |
| (MON1, AT2G28390) gene |
transcript levels were confirmed by |
quantitative real-time PCR (RT-qPCR) |
Arabidopsis thaliana |
| W03g008694 haplotype A |
harbored by |
12 accessions |
Camellia sinensis |
| functional enrichment analysis |
identified three categories over-represented in |
mesophyll cells |
Oryza sativa |
| nuclear analyses |
are particularly useful in |
quantification of single cell gene expression |
|
| environmentally regulated gene networks |
are increasingly investigated with |
advanced 'omics methods |
|
| k-mer approach |
is a suitable strategy for |
hybrid gene expression analysis |
Festuca pratensis; Lolium multiflorum |
| 279 genes in F1 Festuca × Lolium hybrids |
displayed higher expression of |
Lolium homoeolog |
Festuca pratensis; Lolium multiflorum |
| Festuca homoeolog |
was upregulated in |
136 (91.0%), 160 (87.9%), and 155 (83.8%) genes in category II |
Festuca pratensis; Lolium multiflorum |
| 14 genes encoding enzymes and regulators |
displayed |
large difference in expression level among time points (1 to 6000 RPKM) |
Craterostigma plantagineum |
| T-DNA insertion mutant lines |
were tested with |
RT-PCR to assess presence or absence of transcript |
Arabidopsis thaliana |
| expression pattern of most of these genes |
were confirmed by |
qPCR |
Prunus persica |
| 13 down-regulated genes |
down-regulated in |
greenhouse and vineyard S + R + plants |
Vitis vinifera |
| transgenic line OX.STOP1-2 |
displayed |
ALTM1 and MATE transcript levels similar to WT |
Arabidopsis thaliana |
| genomics approaches |
explore |
transcription levels |
Zea mays |
| k-mer approach |
is not biased by |
differential mapping efficacy to a reference sequence of either parent |
Festuca pratensis; Lolium multiflorum |
| RNA sequencing studies |
used to differentiate between |
maternal and paternal mRNAs |
|
| RNA-Seq expression |
is |
genomic assay |
|
| parallel sequential FISH (par-seqFISH) |
spatially maps |
gene expression profile of individual bacteria |
|
| RNA sequencing (RNA-seq) |
identified |
95 differentially expressed genes (DEGs) including 60 upregulated and 35 downregulated DEGs |
Gossypium hirsutum |
| 678 and 886 genes displaying Festuca expression dominance and Lolium expression dominance |
were identified in |
both reciprocal hybrids, in F1 and F2 hybrids early after establishment and in F1 and F2 hybrids after 4 years of cultivation |
Festuca pratensis; Lolium multiflorum |
| 448 genes |
identified showing |
significantly different expression levels between Fudingdabai B and other haplotypes |
Camellia sinensis |
| cluster CBS&V |
contained |
1015 genes preferentially expressed in bundle sheath and veinal cells |
Oryza sativa |
| genes |
can be examined for |
expression pattern across hundreds of RNA-seq samples |
Triticum aestivum |
| 530 genes in F1 Lolium × Festuca hybrids |
displayed higher expression of |
Festuca homoeolog |
Festuca pratensis; Lolium multiflorum |
| expression divergence of retained homoeolog pairs |
examined in |
Oryza alta (CCDD) |
Oryza alta |
| expression of GUS reporter gene driven by the MYB46–SNBE1 sequence |
examined in |
transgenic plants |
Arabidopsis thaliana |
| ZmCesA2 |
analyzed using |
gene-specific primers |
Zea mays |
| RT-PCR analysis results |
were consistent with |
RNA-seq analysis at six seed development stages |
Acer truncatum |
| three CYP members (EVM0001614, EVM0008084, EVM0017260) |
highly expressed in |
leaf and stem |
Strobilanthes cusia |
| four expanded UGT members (EVM0023821, EVM0024034, EVM0013737 and EVM0005112) from other four subfamilies (A, E, G and L, respectively) |
significantly expressed in |
leaf and stem relative to root |
Strobilanthes cusia |
| expression profiles recovered from EST library mining |
may well not contain |
low abundance transcripts |
|
| P deficiency treatment |
had no consistent effect on |
HvALMT1 expression |
Hordeum vulgare |
| genes with preferential expression from Festuca homoeolog |
were slightly higher in number than |
genes with preferential expression from Lolium homoeolog |
Festuca pratensis; Lolium multiflorum |
| correlation analysis of transcript and protein levels |
was performed |
transcript and protein levels |
Craterostigma plantagineum |
| 633 and 613 genes with preferential expression from Festuca homoeolog |
were only slightly more than |
576 and 515 genes with preferential expression from Lolium homoeolog |
Festuca pratensis; Lolium multiflorum |
| all 5,790 genes |
were assigned to one of |
seven categories: cis-only, trans-only, cis + trans, cis × trans, compensatory, conserved and ambiguous |
Festuca pratensis; Lolium multiflorum |
| microarray analysis |
was performed in |
roots of plants grown under NO3− −Suc and NH4+ −Suc conditions |
Arabidopsis thaliana |
| TNP2-like transposase genes |
were examined for |
expression levels in different tissues |
Brassica rapa; Brassica oleracea |
| Fudingdabai haplotype A of MSTRG.4268.1 |
displayed significantly higher expression level than |
Fudingdabai haplotype B |
Camellia sinensis |
| (GEX3, AT5G16020) primers for Arabidopsis |
used in |
RT-PCR |
Arabidopsis thaliana |
| α-expansins |
were found in |
microarray study |
|
| high sequence similarity between three pTaExpA6 genes |
means that signal in images is likely to be |
sum of transcript levels of all three sequences |
|
| RT-PCR analysis of endogenous (BP, BP1, KNAT1, AT4G08150) (KNAT6, KNAT6L, KNAT6S, AT1G23380) and (AS1, ATMYB91, ATPHAN, LL2, MYB91, AT2G37630) expression |
was carried out on |
leaves of Agave KNOX- and Arabidopsis KNOX-overexpressing lines |
Arabidopsis thaliana |
| MdAF1 expression in mealy and non-mealy hybrids and parents |
was low for in planta fruits |
in planta fruits |
|
| (HCC1, AT3G08950) (HOMOLOGUE OF COPPER CHAPERONE SCO) expression in leaf primordia |
was not confirmed by |
Genevestigator expression database |
Arabidopsis thaliana |
| (CIPK3, SnRK3.17, AT2G26980) gene |
produces |
PCR product of 1.326 kb |
|
| (AT2353, ATGA20OX2, GA20OX2, AT5G51810) promoter |
drives |
GUS reporter gene expression |
Arabidopsis thaliana |
| RT-PCR |
conducted as described by |
Wen et al. (2003) |
|
| rice U-box protein genes |
have corresponding |
ESTs or full-length cDNAs |
Oryza sativa |
| PpSPY |
was highly expressed in |
rhizome shoots |
Phyllostachys praecox |
| gene expression analysis by microarrays |
offers |
broad insight into gene expression |
|
| promoter-GUS-reporter gene transformation |
identified |
expression patterns of OsNRT2s and OsNAR2.1 |
Oryza sativa |
| 985 and 907 homoeolog pairs with significant differential expression level between parents |
displayed non-biased expression in |
Festuca × Lolium and Lolium × Festuca hybrids |
Festuca pratensis; Lolium multiflorum |
| 885–939 genes in reciprocal hybrids |
were classified as |
unassigned |
Festuca pratensis; Lolium multiflorum |
| next-generation sequencing approaches |
is used for |
expression profiling |
|
| (ATMGT5, MGT5, MRS2-6, AT4G28580) mRNA |
expression pattern analyzed in |
anther |
Arabidopsis thaliana |
| (AGR, AGR1, ATPIN2, EIR1, MM31, PIN2, WAV6, AT5G57090) gene |
was amplified using |
(AGR, AGR1, ATPIN2, EIR1, MM31, PIN2, WAV6, AT5G57090) primers |
Arabidopsis thaliana |
| PtaRHE1 overexpression |
was first checked by |
RT-PCR |
Nicotiana tabacum |
| 318 up-regulated genes |
were identified |
in rhizome buds |
Phyllostachys praecox |
| Nicotiana benthamiana plants grown in sulphur-sufficient conditions |
were used for |
trans-activation studies |
Nicotiana benthamiana |
| 18 subtracted cDNA clones |
were more abundant in pale yellow plants with fold changes greater than |
two |
|
| in situ hybridization |
provides information on |
localization of expansin transcripts in maternal or endosperm tissues |
|
| four genes from refined list |
subjected to |
qRT-PCR analysis |
Solanum tuberosum |
| promoter–GUS reporter transgenic plants |
were used to identify |
OsNAR2.1 and OsNRT2 expression profiles |
Oryza sativa L. |
| MdAF3 gene in relative quantification analysis for fruit samples from individual hybrids |
exhibited differential expression patterns between |
mealy and non-mealy individuals at H1, S1, and S2 collection dates |
|
| hybrids classified as mealy |
showed predominantly higher |
MdAF3 transcription |
|
| microarray raw data |
can be found in supplementary material of |
Richardson et al. (2007 a) |
Hordeum vulgare |
| RAS3 gene |
transcript levels were quantified by |
reverse transcription-quantitative PCR (RT-qPCR) |
Salvia miltiorrhiza |
| 146 UGT members |
expressed in |
at least one tissue with FPKM >0.5 |
Strobilanthes cusia |
| lncRNA000170 promoter-driven GUS transformation |
was carried out to examine |
spatial expression pattern of lncRNA000170 |
Solanum lycopersicum |
| (ATMGT5, MGT5, MRS2-6, AT4G28580) mRNA |
expression pattern analyzed in |
sepal |
Arabidopsis thaliana |
| definitions of the sampled tissues |
vary between |
experiments |
Oryza sativa |
| PpHB1 |
was highly expressed in |
bamboo shoots |
Phyllostachys praecox |
| expression of (ATICS1, EDS16, ICS1, SID2, AT1G74710) (CYP71B15, PAD3, AT3G26830) and (F6'H1, AT3G13610) |
was higher in |
PI tissues than in PU tissues |
Arabidopsis thaliana |
| grain position in spikelet |
did not affect |
expression of expansins |
|
| SrUCPA mRNA |
is present in |
all tissues and stages |
Symplocarpus racenosus |
| 2.5 kb transcript |
ends in |
intergenic region between (ACCD, ATCG00500) and (PSAI, ATCG00510) |
Nicotiana tabacum |
| suppression subtractive hybridization (SSH) and microarray |
were used to |
identify differentially expressed genes linked to bud mutation |
Citrus sinensis |
| (AtLtpI-5, cdf3, LP2, LTP2, AT2G38530) gene expression |
confirmed to be |
highly tissue-specific |
Hordeum vulgare |
| F2 generation |
showed increase in |
cis × trans, cis + trans and compensatory categories |
Festuca pratensis; Lolium multiflorum |
| ZmNL4 |
molecular mechanism was explored using |
comparative transcriptome analysis |
Zea mays |
| 11 of the same loci |
examined for |
expression in Oryza alta |
Oryza alta |
| 431 genes |
identified showing |
significantly different expression levels between the two haplotypes of Fudingdabai |
Camellia sinensis |
| W11g023219 haplotype B |
harbored by |
11 accessions |
Camellia sinensis |
| Spearman ranked correlations of log2-transformed transcripts per million (TPM) values |
indicated distinct patterns of |
gene expression in each cell type |
Oryza sativa |
| cbl9::CIPK3 (WT) transgenic lines |
were confirmed by |
RT–PCR |
Arabidopsis thaliana |
| (LCR77, PDF1.2, PDF1.2A, AT5G44420) probe |
hybridization conditions have been previously described in |
Berrocal-Lobo et al., 2002 |
|
| white box in heat-map |
indicates |
strong down-regulation |
|
| PpRLK1 |
expression was significantly higher in |
young florets |
Phyllostachys praecox |
| PpHB1 |
was highly expressed in |
young florets |
Phyllostachys praecox |
| MdAF3 expression |
was markedly induced at harvest in fruits from |
mealy group in comparison with non-mealy group |
|
| Progeny of six independent transformants |
were analyzed for |
HT-M transcript levels |
Nicotiana plumbaginifolia; Nicotiana alata |
| Os10g34360 (YY2) |
was selected for |
RT-PCR analysis |
Oryza sativa |
| inverse correlation between the level of rescue and the PR-1 transcript expression |
was found |
in qPCR PR-1 transcript analysis |
Arabidopsis thaliana |
| rice U-box genes |
have |
full-length cDNAs |
Oryza sativa |
| ratio for SCN-inoculated and non-inoculated whole roots or root pieces |
is for |
means for biological replicates of root collections taken at the same dpi |
Glycine max |
| PpSPY |
was highly expressed in |
rhizome buds |
Phyllostachys praecox |
| PpRLK1 |
was highly expressed in |
bamboo shoots |
Phyllostachys praecox |
| qRTPCR |
indicated |
HvALMT1 was expressed at a low level relative to HvGAPDH |
Hordeum vulgare |
| cytochrome c 1 precursor gene |
selected as |
reference transcript |
Arabidopsis thaliana |
| MdAF3 transcription in mealy hybrids (M14, M55, and M48) and parental X6683 |
was highly induced in comparison with |
transcription levels observed for non-mealy hybrid (M20, AT1G18680) at harvest in 2007 |
|
| differential gene expression data for five candidate proteins |
supported |
proteomic data |
Brassica juncea |
| (PR-5, PR5, AT1G75040) transcript |
showed transient induction in |
resistant variety at early time-points of mock inoculation |
Brassica juncea |
| RT-PCR analysis |
was performed on |
transgenic plants |
Arabidopsis thaliana |
| elevated expression for some of the (ACS, AT5G36880) genes |
observed in SCN-colonized root pieces is supported by |
lower but similar expression pattern observed in whole root collections |
Glycine max |
| black box in heat-map |
indicates |
strong up-regulation |
|
| PpSINA |
expression in rhizome buds was markedly higher than |
expression of PpHB1 and PpRLK1 |
Phyllostachys praecox |
| RACE and RT-PCR analysis |
performed on |
soybean cultivars Corsoy and Safrana |
Glycine max |
| cDNA SSH between regenerated pale yellow and green plants |
isolated |
nine down-regulated and 18 up-regulated genes in pale yellow plants |
Epipremnum aureum |
| transcript analysis through real-time PCR in barley |
shows reduction in level of transcript is conspicuous only in |
isoform targeted |
Hordeum vulgare |